Table 3

Oligonucleotide primers used in this study
Oligonucleotides Nucleotide sequence (5’ - 3’)
pe.BC.PG ~ 150 bp GTCACCCATGCGGGCCAGCAG
lscB_UpN_f CCCAAGCTTCGATTGCAAGCTGATACACGTACC
lscB_UpN_r TAGGCTAGCTAGAGGACTATTTTTGAG
lscA_ORF_f CTAGCTAGCATGAGTAACATCAATTAC
lscA_ORF_r CCCAAGCTTCGGACGTCATCCTGATCGACAC
lscB_Up_r TAGGCTAGCAATTGATACCTTTAAATAGCTTTGGGAG
lscA_Up_f CGGGATCCAGCAAAGCGCTGTAAAACAGG
lscA_Up_r CTACTAGCTAGCGATGATGTCCTTTATTGGCGC
lscB_ORF_f GCTCTAGATGTCCACTAGCAGCTCTGCTGTAA
lscB_ORF_r CCCAAGCTTTCAGTATTACGGATACGATGAGC
lscA_gly_f TAAGCCCGGATTTTCCGGTC
lscA_gly_r TACTGTATGCGTGCCGCGTT
lscA_pha_f TCACGCTGACGGCTGACCGC
lscA_pha_r GCCTACTGTATGCGTGCCGCG
lscA_syr_f TCACGCTGACAGCTGATCGC
lscA_syr_r ACCAACGGTATGCGTACCGC
lscA_tom_f ATCACCCTGACAGCCGACCG
lscA_tom_r ACCGACAGTATGTGAACCCCGCT
lscA_f_RT ATGAGTAACATCAATTACGCACCC
lscA_r_RT TACTTTGGCAATTGCCGCAC
lscB_f_RT CTCTGCTGTAAGCCAGCTCAA
lscB_r_RT CGGGTGTGACGCAGGTGTAA
gyrA_fw CGAAGAGCTGGAAGTGATCC
gryA_rv GACGCTGAGCCTGATAGACC
hexR_fw ATGGACCGCGTAAGAAAC
hexR_rv TCAGCCTTGATCCTCGATCGG

Restriction sites in the primers are in italics: GAGCTC – SacI, AAGCTT - HindIII, GCTAGC - NheI, GGATCC - BamHI, TCTAGA – XbaI.

Khandekar et al.

Khandekar et al. BMC Microbiology 2014 14:79   doi:10.1186/1471-2180-14-79

Open Data