Table 1

Primer sequences used for the qRT-PCR
Gene Primer sequence 5′ to 3′ Amp size (bp)
ACT1 Forward: GCTGGTAGAGACTTGACCAACCA 87
Reverse: GACAATTTCTCTTTCAGCACTAGTAGTGA
EAP1 Forward: CTGCTCACTCAACTTCAATTGTCG 51
Reverse: GAACACATCCACCTTCGGGA
HWP1 Forward: GCTCAACTTATTGCTATCGCTTATTACA 67
Reverse: GACCGTCTACCTGTGGGACAGT
SAP2 Forward: TCCTGATGTTAATGTTGATTGTCAAG 82
Reverse: TGGATCATATGTCCCCTTTTGTT

Semlali et al.

Semlali et al. BMC Microbiology 2014 14:61   doi:10.1186/1471-2180-14-61

Open Data