Table 4

Primers used in this study
Primer name Sequence (5′ to 3′)*
PllsAchgA(LI) GGCTGCAGAATCCGCGTTCTTG
PllsAchgB(LI) GAGGTTTTAGGGCTTTGCTC
PhelpFsoe(LI) GAGCAAAGCCCTAAAACCTCGAGATCTGCTGG
PhelpRsoe GATGATTGTGATTTAATATTCATGGGTTTCACTCTC
PllsAchgC ATGAATATTAAATCACAATCATC
PllsAchgD TGGAATTCCCAGCTCCATTGTCTC
pORI280For CTCGTTCATTATAACCCTC
pORI280Rev CGCTTCCTTTCCCCCCAT
Lin1080_F1 CGGTACGGATTGTGAATGAAGTGG
llsAFor CGATTTCACAATGTGATAGGATG
llsARev GCACATGCACCTCATAAC
1113for GTTATGAGGTGCATGTGC
1114rev GTCTGGGATATGTAGTCC
1115 rev CACTAGCATGATGTTTATAGGGG
1118rev CATGACAAGCAGTGCCTGTTGATACAGC
1120rev CGTTCCCCCTCCTTTTTAGAGCAG
araCrev CTCTCCTTTTCATTAGCCTGC
actA1-f AATAACAACAGTGAACAAAGC
actA1-r TATCACGTACCCATTTACC
plcB2-f TTGTGATGAATACTTACAAAC
plcB2-r TTTGCTACCATGTCTTCC
actA3-f CGGCGAACCATACAACAT
plcB3-r TGTGGTAATTTGCTGTCG

*Restriction site in bold and SOE overhang italicised.

Clayton et al.

Clayton et al. BMC Microbiology 2014 14:58   doi:10.1186/1471-2180-14-58

Open Data