Table 4

Oligonucleotides used
Name Sequence (5′ to 3′) Specificity
Rg70f3 GTTCATCCCGAGGACCATCAGTC Sense primer for KU70 3′ RACE Specific primer for ∆ku70 fungi colony PCR
Rg70r3 GGGATGAGCTCCTTGAGCTTTGC Antisense primer 1 for KU70 5′ RACE
Rg70r4 TCTTCGTCCGGGTAGATGAAGTAG Antisense primer 2 for KU70 5′ RACE
Rg70r5 ATCCTTTGGGCTGGCGATGACTTTG Antisense primer 3 for KU70 5′ RACE
Rg80f2 GTCGCTTGAGCGCATCTTCAACAAG Sense primer for KU80 3′ RACE
Rg80r2 ATCACGATGTCCTCGTCCTCGTCGT Antisense primer 1 for KU80 5′ RACE
Rg80r3 CTCCAACCTGCGGACATGCTTCTT Antisense primer 2 for KU80 5′ RACE
Rg80r4 GAAGCGAGCCTTGCGCTTGATCTCG Antisense primer 3 for KU80 5′ RACE
Rg70Lf CTCGTGTCAAGAAAACCAGCAAG KU70 gene deletion region
Rg70Rr ACCTCAGCAACCAACCTACCAGT
C50f TCCTCCTACCGACGCTCTACC CAR2 deletion region (50 bp homology length)
C50r CTCTGTGCAGCCATCTCGTTC
C100f TTCATTGCCTCAACCCACATC CAR2 deletion region (100 bp homology length)
C100r CGTCCCCAATGCTGAGATAAA
C250f CAAAGTTGGAGGAGGGAGGAG CAR2 deletion region (250 bp homology length)
C250r GTTGAGAAACCAGCGAGACCA
C500f CCTGGGACTCGTACCTCATCC CAR2 deletion region (500 bp homology length)
C500r GCGACCGCGACTGACTAGTTT
Rt079 GGACTGGACTACTGGCTCGTGT CAR2 deletion region (750 bp homology length)
Rt080 TCAAGAGCTACCAGGAGAGCAAC CAR2 deletion region (750 bp homology length) CAR2 complementation region
C1000f GGGGCTGTCTGTGACTTGCTAT CAR2 deletion region (1000 bp homology length)
C1000r TCGAGCTCAAGCTGAAGAAGAAG
C1500f CTCTCGCACGGGGAGGTAGT CAR2 deletion region (1500 bp homology length) CAR2 complementation region
C1500r TGCTTGCCAAGAAGCCTACAATA CAR2 deletion region (1500 bp homology length)
STE20Lf GCTCGTGTTGCGGGAACAGT STE20 deletion region
STE20Rr GGGCACGCCTTCTTCAAGAAC
Rt033 GTCAAGCCGCCCAGGCTGTC URA3 deletion region
Rt034 GGATCCGCCAAGTCGCGCAG
Rg70r2 GTCCTTCTTCACCACGCGTTTCTT Specific primer for ∆ku70 fungi colony PCR
Rt096 CGAATCCAACATCGACATGATTT Specific primer for ∆car2 fungi colony PCR
Rt097 TATTGACGAGCTGAAGAGCCTGT
Rt006 TCTCCCTCGCCCTCTGCT Specific primer for GPD1 (reference gene) in multiplex PCR
Rt007 AGCCATGCCGGTGAGCTTG
Rt100 GACCCGACAGACGAGTGGAC KU70 probe for Southern blot
Rt101 AGGTCCTTGAGAAAGCGGATG
Rt083 CTCACCCTCGTGTTGCTCGTA CAR2 probe for Southern blot
Rt084 CCTCTCCTCCCTCCTCCAACT

Koh et al.

Koh et al. BMC Microbiology 2014 14:50   doi:10.1186/1471-2180-14-50

Open Data