Table 1

Primers sequences, annealing temperatures, and expected fragment sizes of PCR reactions targeting specific genes for identification and bacteriocins encoding genes
Target Primers sequences (5'-sequence-3') Fragment size (bp) Annealing Reference
16S rRNA GCGGCGTGCCTAATACATGC 700 42°C [29]
ATCTACGCATTTCACCGCTAC
pheS CAYCCNGCHCGYGAYATGC 470 46°C [30]
CCWARVCCRAARGCAAARCC
lanB TATGATCGAGAARYAKAWAGATATGG 400-500 40°C [17,19]
TTATTAIRCAIATGIAYDAWACT
lanC TAATTTAGGATWISYIMAYGG 200-300 40°C [17,19]
ACCWGKIIIICCRTRRCACCA
lanM ATGCWAGWYWTGCWCATGG 200-300 40°C [17,19]
CCTAATGAACCRTRRYAYCA
nis GGATAGTATCCATGTCTG 250 55°C [31]
CAATGATTTCGTTCGAAG
entA CATCATCCATAACTATATTTG 126 56°C [32]
AAATATTATGGAAATGGAGTGTAT
entB GAAAATGATCACAGAATGCCTA 162 58°C [32]
GTTGCATTTAGAGTATACATTTG
entP TATGGTAATGGTGTTTATTGTAAT 120 58°C [32]
ATGTCCCATACCTGCCAAAC
entL50AB STGGGAGCAATCGCAAAATTAG 98 56°C [32]
ATTGCCCATCCTTCTCCAAT
entAS48 GAGGAGTITCATGATTTAAAGA 340 56°C [32]
CATATTGTTAAATTACCAAGCAA

Perin and Nero

Perin and Nero BMC Microbiology 2014 14:36   doi:10.1186/1471-2180-14-36

Open Data