Table 2

qPCR settings and relative transcript abundance
Target gene Primer sequence (5′-3′)a Product size (bp) PCR efficiency Expression ratiob
spxB fwd: TACCGGAAACTGCTTGGTATC 155 1.93 8.97
rev: CTGGAAAACCGCATCTTTGT
ulaE fwd: CACTAGCCAAATCAATCGCC 90 2.05 5.78
rev: GCCATCGTCGGTTTCCATTA
xfp fwd: CGTGAAGAAGGCGATATC 215 2.01 5.98
rev: TTCCAAGTCCACTCCTGA
16S rDNA fwd: GCYTAACACATGCAAGTCGA 500 1.85 /
rev: GTATTACCGCGGCTGCTGG

aPrimer sets were designed based on the sequences of cDNA-AFLP fragments. Primers for 16S rDNA gene were designed as reported by Giraffa et al. [24].

bTarget gene expression was calculated relative to 16S rDNA as a reference gene using the efficiency-corrected ΔΔCT method [23]. The relative expression ratios in CB compared to MRS are shown.

Lazzi et al.

Lazzi et al. BMC Microbiology 2014 14:28   doi:10.1186/1471-2180-14-28

Open Data