Table 3

SNP location, primers and PCR designed for pyrosequencing analysis
PCR primer sequence (5′ → 3′)
Geneª SNP locationª PCRb Amplicon (bp)b Forwardb Reverseb
dnaA:dnaN 1977 Multiplex 1 131 [M13] - TGAGAAGCTCTACGGTTGTTGTTCG TTTCACCTCACGATGAGTTCGATCC
(Rv0001:Rv0002)
Rv0260c 311613 114 CACCACTGTTGCCACGATGTTCTT [M13] - GGCGACTTGCTACGCGTCCTAC
icd2 (Rv0066c) 74092 Multiplex 2 88 [M13] - GACGGTCCGAATTGCCTTGG GACCAGGAGAAGGCCATCAAAGAG
phoT (Rv0820) 913274 141 GCAATCGCCGTGCAACC [M13] - CTGCATGTTATGGGTGACGATGAC
Rv0095c 105139 Multiplex 3 94 ATAACGTCGGGCACTGACAAAGAG [M13]-TCCCGTATCAACTCGTAGGATCTGG
Rv0197 232574 81 CCACGGCGGGGACAAGAT [M13] -AGAAAGGCGCCGCTGTAGG
qcrB (Rv2196) 2460626 Multiplex 4 120 [M13] - GGGCTCGCAGCCAGACTTC ATGATCACGGCGACCCAGAC
leuB (Rv2995c) 3352929 108 [M13] - TCGACGTCCGGGTAGCATTC GCGTCGCAAGCATCTGACATT
gyrA (Rv0006) codon 95 Simplex 320 CAGCTACATCGACTATGCGA [M13] - GGGCTTCGGTGTACCTCAT
Universal primer
[M13]: CGCCAGGGTTTTCCCAGTCACGAC

aGene name and SNP location in M. tuberculosis H37Rv genome map (http://tuberculist.epfl.ch/ webcite). One gene is listed when SNP location is situated in that gene and two genes are listed when SNP is intergenic.

bPCR name, amplicon expected size, and primers used.

Cabal et al.

Cabal et al. BMC Microbiology 2014 14:21   doi:10.1186/1471-2180-14-21

Open Data