Table 3

The primers used in PCR amplification and sequencing for confirmation of the mutation
Gene Forward Reverse Annealing temperature
dltA AAGTAGTGCAGTTTAGGAGAGGA AGATTGTACCACCGGATGTC 58.0
gtcA TTGAGCTCTTAGTAGAACCTGAC CTGGTTTCGCTATCTCATTAG 54.5
iap CAAAATGCTACTACACACGCT GTCAAAGAATACTAAATCACCAGC 56.5

Kyoui et al.

Kyoui et al. BMC Microbiology 2014 14:15   doi:10.1186/1471-2180-14-15

Open Data