Table 1

Primers used in the study
Loci Primers Sequences Annealing T° (time) Expected size Reference
katG F 5′-GAAACAGCGGCGCTGATCGT-3′ 66°C (1 min) 210 bp [21]
R 5′- GTTGTCCCATTTCGTCGGGG- 3′
fabGI-inhA F 5′-CCTCGCTGCCCAGAAAGGGA-3′ 64°C (1 min) 248 bp [21]
R 5′-ATCCCCCGGTTTCCTCCGGT-3′
inhA (ORF) F 5′- GAACTCGACGTGCAAAAC – 3′ 55°C (45 sec) 207 pb [18]
R 5′- CATCGAAGCATACGAATA – 3′
ahpC F 5′-ACCACTGCTTTGCCGCCACC-3′ 65°C (1 min) 237 bp [21]
R 5′-CCGATGAGAGCGGTGAGCTG-3′
rpoB F 5′-TCGCCGCGATCAAGGAGT-3′ 62°C (30 sec) 158 bp [21]
R 5′-GTGCACGTCGCGGACCTCCA-3′
rrs530 F 5′-GATGACGGCCTTCGGGTTGT-3′ 62°C (1 min) 238 bp [12]
R 5′- TCTAGTCTGCCCGTATCGCC -3′
rrs912 F 5′- GTAGTCCACGCCGTAAACGG -3′ 62°C (1 min) 240 bp [12]
R 5′- AGGCCACAAGGGAACGCCTA -3′
rpsL F 5′- GGCCGACAAACAGAACGT -3′ 58°C (30 sec) 375 bp [12]
R 5′- GTTCACCAACTGGGTGAC -3′
embC F 5′- GTTCGACAAGCGCGCCACAC -3′ 65°C (45 sec) 334 bp [22]
R 5′- CGGAGGTAGATGGTAGCCGG -3′
embA F 5′- GCCGGCTATGTAGCCAACTA -3′ 65°C (45 sec) 338 bp [17]
R 5′- GACCGTTCCACCAACACC -3′
embB F 5′- CCGACCACGCTGAAACTG -3′ 65°C (45 sec) 368 bp [23]
R 5′- GTAATACCAGCCGAAGGGATCCT -3′
gidB F 5′-CGCCGAGTCGTTGTGCT-3′ 62°C (1 min) 886 pb -
R 5′-AGCCTGGCCCGACCTTA-3′

T° = Temperature.

Tekwu et al.

Tekwu et al. BMC Microbiology 2014 14:113   doi:10.1186/1471-2180-14-113

Open Data