Table 1

Primer sequences used in this study
Primer Sense primer Antisense primer Accession number
β-actin TGG ATT GGC GGC TCC AT GCT GAT CCA CAT CTG CTG GAA NM_173979
TLR1 CAT TCC TAG CAG CTA CCA CAA GCT TGG GCC ATT CCA AAT AAG TTC T NM_001046504
TLR2 GGG TGC TGT GTC ACC GTT TC GCC ACG CCC ACA TCA TCT NM_174197
TLR3 GGG CAC CTG GAG GTC CTT TTC CTG GCC TGT GAG TTC TTG NM_001008664
TLR4 AGC ACC TAT GAT GCC TTT GTC A GTT CAT TCC GCA CCC AGT CT NM_174198
TLR5 GTC CCC AAC ACC ACC AAG AG GCG GTT GTG ACT GTC CTG ATA TAG NM_001040501
TLR6 TTT ACC CTC AAC CAC GTG GAA GGG CCA AAG GAA CTG AAA AAC NM_001001159
TLR7 CAC CAA CCT TAC CCT CAC CAT T GTC CAG CCG GTG AAA GGA NM_001033761
TLR8 TGT GTT TAG AGG AAA GGG ATT GG TCT GCA TGA GGT TGT CGA TGA NM_001033937
TLR9 CAG TGG CCA GGG TAG TTT CTG CCG GTT ATA GAA GTG ACG GTT GT NM_183081
TLR10 TCT ACT GCA TCC CTA CCA GAT ATC C GGG CCA TTC CAA GTA TGC TTT NM_001076918
MCP-1 CAC CAG CAG CAA GTG TCC TAA A CAC ATA ACT CCT TGC CCA GGA T NM_174006
TNF-α CGC ATT GCA GTC TCC TAC CA GGG CTC TTG ATG GCA GAC A NM_173966
TGF-β CGT GGA GCT GTA CCA GAA ATA TAG C CGA GCA GCC GGT TGC T NM_001166068
IFN-α GGT GGC AGC CAG TTA CAG AAG TGC TGG GTC ACC TCA TGG A Z46508
IFN-β CGA TGG TTC TCC TGC TGT GTT GAG CAA GCT GTA GCT CCT GGA A EU276065
IFN-γ GGA GGA CTT CAA AAA GCT GAT TCA GGC TTT GCG CTG GAT CTG NM_174086
LIF CTG TCC CAG CAA CCT CAT GA TGG CAC TGC TGT TGA GTT GTC NM_173931
IL-1α CAG TTG CCC ATC CAA AGT TGT T TGC CAT GTG CAC CAA TTT TT NM_174092
IL-1β GAG CCT GTC ATC TTC GAA ACG GCA CGG GTG CGT CAC A NM_174093
IL-4 GCC ACA CGT GCT TGA ACA AA TGC CAA GCT GTT GAG ATT CCT NM_173921
IL-6 CCA CCC CAG GCA GAC TAC TTC CCA TGC GCT TAA TGA GAG CTT NM_173923
IL-7 CAA GCT TCA CCT ATC AAC AGT TTC A CCC TTG CTG GTG CAG TTC A NM_173924
IL-8 TGC TCT CTT GGC AGC TTT CC TCT TGA CAG AAC TGC AGC TTC AC NM_173925
IL-10 GGC GGT GGA GAA GGT GAA GGC TTT GTA GAC ACC CCT CTC TT NM_174088
IL-12 CAG CAA GCC CAG GAA GGA TGA CAG CCC TCA GCA GGT TT NM_174355
MKP-1 CGCAGCGCGCAAATCT CGGGTAGGAAGCAGAAAAAGC NM_001046452
IRAK-M ACAGCGGAGCGGCTTTC CTTGGTCTACATATTTTTCAATGTGA NM_001190299
SIGIRR GGCAGTGAAGTGGATGTGTCA TCCGTGCGGGCACTGTA NM_001082443
BCL3 CATGGAACACCCCCTGTCA GGCGTATCTCCATCCTCATCA NM_001205993
Tollip CGGGCGTGGACTCTTTCTAC GATGCGGTCGTCCATGGA NM_001039961
ABIN-3 CGCAGAACGAATTGCTGAAA CACTACGCTCCCTCTGGAAGTC BC102932

Takanashi et al.

Takanashi et al. BMC Microbiology 2013 13:54   doi:10.1186/1471-2180-13-54

Open Data