Table 2

PCR primers used in this study
Gene target Primer sequence (5’-3’) Probe Ta* Amplicon size (bp) Reference
Forward Reverse
ompW TCCTCAACGCTTCTGTGTGGTAT ATTGATTTCAACATCCGTGGATT FAM-TGAAACAACGGCAACCTACAAAGCAGG-BHQ1 55 92 This study
hlyA AGTGGTCAACCGATGCGATT TTCAGGATCTGCGCTTTATTGTT ROX-CCCAAGATTATCGCTTCGTGTTTAACGCA- BHQ2 47-55 76 This study
toxR GATTCGACAAAGTCCCCACAA TCGGGCGATCAATTGGTAA HEX-CGTCAAAACGGTTCCGAAACGCG-BHQ1 47-55 66 This study
ctxAB CTCAGACGGGATTTGTTAGGCACG TCTATCTCTGTAGCCCCTATTACG - 55 303 [39]
tcpA (1)# GTGACTGAAAGTCATCTCTTC AATCCGACACCTTGTTGGTA - 55 1248 [40]
tcpA (2)# ATATGCAATTATTAAAACAGC TTATTATTACCCGTTGTCGG - 55 1052 [40]
ace AGAGCGCTGCATTTATCCTTATTG AACTCGGTCTCGGCCTCTCGTATC - 55 655 [41]
zot GCTATCGATATGCTGTCTCCTCAA AAAGCCGACCAATACAAAAACCAA - 55 1000 [41]
T3SS (vcsC2) GGAAAGATCTATGCGTCGACGTTACCGATGCTATGGGT CATATGGAATTCCCGGGATCCATGCTCT AGAAGTCGGTTGTTTCGGTAA - 47-60 535 [16]
T3SS (vcsV2) ATGCAGATCTTTTGGCTCACTTGATGGG ATGCGTCGACGCCACATCATTGCTTGCT - 47-55 742 [16]
NAG-ST CCTATTCATTAGCATAATG CCAAAGCAAGCTGGATTGC - 47-55 215 [16]

*Ta – Annealing temperature.

# Two primer pairs of tcpA primers were used. These two primer pairs have been used previously to amplify divergent tcpA alleles [24].

Luo et al.

Luo et al. BMC Microbiology 2013 13:52   doi:10.1186/1471-2180-13-52

Open Data