Table 1

Spacers characteristics used in this study
Name Genome position* Framing genes* PCR primers PCR product size (bp)
Spacer 1 106145-106396 MAB_0104:enoyl-CoA hydratase/isomerise F : GGGATGCGCAGATGACGGGG 506
MAB_0105c:oxidoreductase R : GCTACCCCGAATGGGGCACG
Spacer 2 173727-173985 MAB_0176:antigen 85-A precursor F : TCGAGTTTCCTCCGGGCGGT 438
MAB_0177:antigen 85-A/B/C precursor R: AATCCAGGCAGAACGGCCGC
Spacer 3 422777-423027 MAB_0423c:hypothetical protein F: GCCATTGCTGTCCGTGCGGT 344
MAB_0424:putative protease R : GCCGCGAACAGGCCAAACAG
Spacer 4 494411-494670 MAB_0495c:hypothetical protein F: CGCCCTTGCGCAGGAGTGAT 528
MAB_0496c:hypothetical protein R: GCCTGGTTCGGACGGTGACG
Spacer 5 761805-762060 MAB_0761c:putative 3-hydroxyacyl-CoA dehydrogenase F : ACCACATCGGCGAGCGTGTG 545
MAB_0762:hypothetical protein R : CCAACACCGGGTCGCGGTAC
Spacer 6 771170-771436 MAB_0772c:hypothetical protein F : CGTCGGTCTTGCCGACCGTC 600
MAB_0773:hypothetical protein R : GGCGCCGACGATCTAGCACC
Spacer 7 880381-880639 MAB_0887c:hypothetical protein F: CGGCAGTGCAAGGTGCGTTG 519
MAB_0888c:putative fumarylacetoacetase R : GCACCGTGTCCGGTCCTCAG
Spacer 8 959422-959678 MAB_0950c:putative amino acid permease family protein F: GGGGCGTATGCGCCGTTACC 474
MAB_0951:putative aminoglycoside phosphotransferase R : CGAACGCGCTGTGATTCGGC
Spacer 9 1002935-1003200 MAB_0995:hypothetical protein F : GGCCGCGACAAGCTGATCGT 684
MAB_0997c:hypothetical protein R: ATGCAGGGCACCGTGCGTAG
Spacer 10 1216613-1216879 MAB_1201c:transcription elongation factor GreA F: CGTTCTCGCGCAGGTCTCCC 517
MAB_1202c:hypothetical protein R: CCGAACGATCCGTGCCGGTC
Spacer 11 1818877-1819188 MAB_1818:hypothetical protein F: AGCCAACTGCCATGGCGCTT 495
MAB_1819c:hypothetical protein R : ACCGAGACGTCATGCACCGC

* With reference to M. abscessus ATCC 19977 genome.

Sassi et al.

Sassi et al. BMC Microbiology 2013 13:3   doi:10.1186/1471-2180-13-3

Open Data