Table 2

Primers used in this study
Primer name Oligonucleotide (5′-3′)a Application
up-airSR-f CCGgaattcTACATCTTGTGCCTTAG airSR deletion
up-airSR-r ATTTGAGatcgatAATGTTCAG airSR deletion
down-airSR-f CGATTTAAGTggtaccGTTGCATGATGTG airSR deletion
down-airSR-r CGCggatccCCTTAAGTTGTTGGAA airSR deletion
Em-f CGGatcgatGATACAAATTCCCCGTAGGC airSR deletion
Em-r CGGggtaccGAAATAGATTTAAAAATTTCGC airSR deletion
c-airSR-f CGCggatccATCGTCGCCAGTATG ΔairS complementation
c-airSR-r CCGgaattcTGAAGCGAAAGTAAATG ΔairS complementation
e-airR-f GGAATTCcatatgAACAAAGTAATATT expression of AirR
e-airR-r CCGctcgagAATCAACTTATTTTCCA expression of AirR
e-airS-f GGGAATTCcatatgATGGAACAAAGGACGCGACTAG expression of AirS
e-airS-r CCGctcgagCTATTTTATAGGAATTGTGAATTG expression of AirS
RTQ-cap5B-f GCTTATTGGTTACTTCTGA real-time RT PCR
RTQ-cap5B-r GTTGGCTTACGCATATC real-time RT PCR
RTQ-cap5D-f ATATGCCAGTGTGAGTGA real-time RT PCR
RTQ-cap5D-r CGGTCTATTGCCTGTAAC real-time RT PCR
RTQ-lytM-f CATTCGTAGATGCTCAAGGA real-time RT PCR
RTQ-lytM-r CTCGCTGTGTAGTCATTGT real-time RT PCR
RTQ-640-f TGATGGGACAGGAGT real-time RT PCR
RTQ-640-r TATTGTGCCGCTTCT real-time RT PCR
RTQ-953-f GTCATTGAGCACGATTTATT real-time RT PCR
RTQ-953-r TCTGGGCGGCTGTAA real-time RT PCR
RTQ-pbp1-f AGTCAGCGACCAACATT real-time RT PCR
RTQ-pbp1-r AAGCACCTTCTTGAATAGC real-time RT PCR
RTQ-murD-f TTCAGGAATAGAGCATAGA real-time RT PCR
RTQ-murD-r AACCACCACATAACCAA real-time RT PCR
RTQ-1148-f GCCGAAGTGACATAC real-time RT PCR
RTQ-1148-r AAGCACCGACTGATA real-time RT PCR
RTQ-ddl-f TAGGGTCAAGTGTAGGT real-time RT PCR
RTQ-ddl-r GTCGCTTCAGGATAG real-time RT PCR
RTQ-pta-f AAAGCGCCAGGTGCTAAATTAC real-time RT PCR
RTQ-pta-r CTGGACCAACTGCATCATATCC real-time RT PCR
p-cap5A-f TCATCTAACTCACCTGAAATTACAAAA EMSA
p-cap5A-r TTTCCATTATTTACCTCCCTTAAAAA EMSA
p-ddl-f CAAACTCCTTTTATACTC EMSA
p-ddl-r GTCATTTCGTTTTCCT EMSA
p-pbp1-f GATTCAATAGAACAAGCGATT EMSA
p-pbp1-r AGCTACACGTAATTTCGCGCTT EMSA
p-lytM-f GAATCGCGAACATGGACGAA EMSA
p-lytM-r GCAATCGCTGCTGCTGTTAA EMSA

aThe sequences in lowercase letters refer to the restriction endonuclease recognition sites.

Sun et al.

Sun et al. BMC Microbiology 2013 13:286   doi:10.1186/1471-2180-13-286

Open Data