Table 3

List of primers used for PCR amplification of protein-encoding genes from Treponema denticola strains
Gene Primer Sequence(5to 3) Strains amplified
dnaN dnaNF ATGAAAATAAGTTTTGACAGAGACAC dnaF + dnaR: all strains (55-50°C)
dnaNR TTACTCCGTCTGCATAGGC
recA recAF1 GTGGCAAAAGCAAAAAAC recAF1 + recAR1: most strains (55-47°C)
recAR1 TTAAAAAAGACTGTCGTCCG recAF2 + recAR2: ATCC 700768, MS25 (54-47°C)
recAF2 TTCATATTGGCCGCATTTG recAF1 + recArecAR2: ATCC 700771 (55-49°C)
recAR2 TTGTGTACTCATAATGCCGCTC
recAF GTGGCAAAAGCAAAAAACGAAG recAF + recAR: OMZ852, OMZ853, NY531, NY553 (58-53°C)
recAR TTAAAAAAGACTGTCGTCCGCC
radC radCF1 ATGATAGACTATAAAAATTCGTCCAATAC radCF1 + radCR1: most strains (55-50°C)
radCR1 TTAAATATCAAACCTCGTTCCG radCF1 + radCR2: MS25 (55-49°C)
radCF2 AACATGGCTTTCCGAAATC radCF2 + radCR1: ATCC 700768 (55-49°C)
radCR2 GTGCAGCGGCTCTAAAAG
ppnK TDE1591F1 ATATGGATCCCATATGAAAAAAG TDE1591F1 + TDE1591R1: most strains (52-45°C)
TDE1591R1 AATTCTCGAGTCAATTCAGTTTGGG TDE1591F2 + TDE1591R2: OKA3, MS25,GM1, ST10A,
TDE1591F2 AGCTACCCTGCCCTAATTTC ATCC 700768, ATCC 700771 (57-52°C)
TDE1591R2 AACATCCTTAAAAAGCGGC
flaA TDE1712F ATGAAAAAAACATTTATACTTGTTG TDE1712F + TDE1712R: all strains (52-46°C)
TDE1712R TTATTGTTGGTTCTTTTCGG
era eraF1 ATGAACAGCGGAGTTGTAAC eraF1 + eraR1: most strains (55-50°C)
eraR1 TTAATACGAGATTTTTTTTATGATATTATC
eraF2 GGTACTTGTGCTTACCGAAAAC eraF2 + eraR2: MS25 (54-47°C)
eraR2 CCGACACAATCGAGGAAG
eraF4 CGCTTAGAAGAAGGGGATGC eraF4, eraR4 separately used for direct chromosome sequencing of ATCC 700768
eraR4 CTTTTTCGACATAGAGGAAGGC
pyrH pyrHF ATGGTAACTGTTTTGTCGGT pyrHF + pyrHR: all strains (54-47°C)
pyrHR TTAGCCGATTACCGTTCCTT

Genetic loci are based on the ATCC 35405 type strain of Treponema denticola.

F: Forward primer; R: Reverse primer. Values in parenthesis indicate annealing temperatures used in ‘touchdown PCR’ procedures.

PCR amplification was unsuccessful; sequencing of chromosomal DNA employed.

Mo et al.

Mo et al. BMC Microbiology 2013 13:24   doi:10.1186/1471-2180-13-24

Open Data