Table 2

Oligonucleotide primers used in RDA assay and qRT-PCR
Sequence name Forward primer (5′- 3′) Reverse primer (5′- 3′) Reaction
cDNA AGCAGTGGTATCAACGACAGAGTACGCGGG Synthesis of the first-strand for RDA
CDS AAGCAGTGGTATCAACGCAGAGTACT(30)N1N Synthesis of the first-strand for RDA
PCRII AAGCAGTGGTATCAACGCAGAGT Synthesis of the first-strand for RDA
JBam12, 24 GATCCGTTCATG ACCGACGTCGACTATCCATGAACG Adapter 1 (RDA)
NBam12,24 GATCCTCCCTCG AGGCAACTGTGCTATCCGAGGGAG Adapter 2 (RDA)
T7 GTAATACGACTCACTATAGGGC Sequencing
Oligo (dT)15 AAGCAGTGGTATCAACGCAGAGTACT(30)N1N3′ Synthesis of the first-strand for qRT-PCR
CAP20 CCTTCACGAACTCGCCACTAT TCGCTGCTTAGGGAGTCTGC qRT-PCR
FKS1 GACAACAGAGGGTATAATGGG GCCATATTGATAGCCTGCAGC qRT-PCR
GLN1 CGATCAAAAACAAAGACCCT GGTCTGGGTACATGGCAAC qRT-PCR
KRE6 GGTATATGCCTAACTTTGAATTC GCGTAGACTTGATACTCTTTTG qRT-PCR
GAC1 AGTACTGCTTCTATGGATCTTC ACTATTTCCTGGGGTCGTTG qRT-PCR
MFS CTAATTATGTTCTTTTGGGGTAC GCATCGCCTATACCAACAAGA qRT-PCR
PAL1 TGCTGCGGAACTCTTTGA GGGCTTATCGTCGGAGAGTC qRT-PCR
ERG3 CACTTGGATCTTCGGCCTAAT TGCATAGCCACGGACTTCGA qRT-PCR

(N1 = A, G or C/N = A, C, G or T).

Zambuzzi-Carvalho et al.

Zambuzzi-Carvalho et al. BMC Microbiology 2013 13:227   doi:10.1186/1471-2180-13-227

Open Data