Table 2

Primers used for characterization and real-time PCR
Gene Forward primer (5’-3’) Reverse primer (5’-3’) Reference
16S CGGGGAGGAAGGTGTTGTG GAGCCCGGGGATTTCACATC [38]
hilA CGCTGGCAGAATGCTACCTC AGCCCCAGTAATCCTAAAGCTTG [39]
prgH GCTCTTTCTTGCTCATCGT ATCTCTATCTGGCTGGATACCT This study
invF ATGTGAAGGCGATGAGTAAC GCTGCTGAATAGTGTAGAAGG This study
tetA GCTACATCCTGCTTGCCTTC CATAGATCGCCGTGAAGAGG [13]
tetB GCTTTCAGGGATCACAGGAG CCAAGACCCGCTAATGAAAA [13]
tetC GCATAAACCAGCCATTGAG GGTAAACGCCATTGTCAG This study
tetD GATGTGGCGAATAAAGCG CCAGTGTGACCCCTGTTAC This study
tetG CCTTGCAGGCAATGCTCTCAAACA AGATTGGTGAGGCTCGTTAGCGTT [40]
thdF-S001 GGGACGGATTTTCTCCAG CGAGTTAGGGTTACGCTTG This study
S013 CCACAATTTGGCTGTGATGGCTCA TGGTCGTGTTATTAGCGGCCAGAT [40]
S044 TGGACGCTCGAAGAGGTAGAG AAGGATGGCCGTCGTCACT [40]

Brunelle et al.

Brunelle et al. BMC Microbiology 2013 13:202   doi:10.1186/1471-2180-13-202

Open Data