Table 2

Primers used in this study
Primer name Sequence (5’-3’)
recUp1 ATCG
    AGATCT
ATGTACTTCAGGTGCGT
recUp2 TAGACTTTTTAAAATTTCACCACACAAGTTTGGTAG
recUp3 ACTTGTGTGGTGAAATTTTAAAAAGTCTATAAC
recUp4 ATCG
    GGATCC
CAATGTTTTGACGTTC
recUp5 TGGTGTATTGTGTCTTTCG
recUp6 TTCCCACCATTATTACCG
recUp7 ATCTGCATGCTTAATTATGTTGGC
recUp8 ATA
    CCCGGG
TGTGTGGTGAAATTTATG
recUp9 TATG
    CTCGAG
TCATACGCGGTCC
spoIIIEp1 GCTGC
    GGTACC
GTCATAGCTATTTTAGTAGTTG
spoIIIEp2 GCTGC
    GGTACC
GGAGGCGCCGCAGGACACCTCGTCATTATTAAGATC
spoIIIEp3 TGA
    GGATCC
GATGAAAAATTCCCGTCT
spoIIIEp4 TACTC
    CCCGGG
TTACTTGTACAGCTCGTCC
spoIIIEp5 TACTC
    CCCGGG
CGGTCCACAAAAAGGAAG
spoIIIEp6 TGCATT
    CCATGG
GACATGCTGATCTTTGAATTTTGAAATTG

Underlined sequences correspond to the restriction site. Bold sequences correspond to the five codon linker.

Pereira et al.

Pereira et al. BMC Microbiology 2013 13:18   doi:10.1186/1471-2180-13-18

Open Data