Table 3

Couples of primers used in this study
Gene Primer name Primer sequence Amplicon size (pb) Reference
16S RRNA Leg225 5 AAGATTAGCCTGCGTCCGAT 654 [18]
Leg858 5 GTCAACTTATCGCGTTTGCT
mip mipLesnsens 5 ATGAAGATGAAATTGGTGACTGCAG 607 [11]
mipLensrev 5 CAACGCTACGTGGGCCATA
lpg1905 lpg1905sens 5 TTGCCTAAAACTCACCACAGAA 528 [18]
lpg1905rev 5 ATGCCGCCCAAAATATACC
lpg0774 lpg0774sens 5 TGCTAACAACCACTATCCCAAA 155 [18]
lpg0774rev 5 GTTTCAATAAAAGCGTGCTCCT
wzm wzmsens 5 ATGACCTCAATATCCTCAAAAACTCAG 833 [11]
wzmrev 5 TTATGCTCCATGTGATGAAATGC

Chaabna et al.

Chaabna et al. BMC Microbiology 2013 13:17   doi:10.1186/1471-2180-13-17

Open Data