Table 2

CtrA binding sites for CtrA-regulated genes
Gene CtrA binding site Ref.
Canonical CtrA xxxxTTAAxxxxxxxTTAAxxx [17]
ctrA-P1 ATTCGCAAATCAGATTAACCA [9]
ctrA-P2 CCATTAACCAGTCTTAAATTAACTC
ftsZ CAGTTAACCGCCGATTAACGA [18]
ftsQA CCGTTATGACGACATTAACGA [19]
ccrM TGGTTAACGGCCCGCTAACCA [26]
fliQ CCCCTAACGCCCTGTTAACCA [17]
pilA–Region 1 CTGTTTACTGGCCATTAAGTG [22]
Region 2 TGGTTAAGAACAAATAACGGTAAATACAAATAAACCA
Region 3 TGGTCAACAAAAGACTAAAAT

TTAA half sites are indicated in bold.

Curtis et al.

Curtis et al. BMC Microbiology 2013 13:166   doi:10.1186/1471-2180-13-166

Open Data