Table 6

Primers used in this study
Primers Sequence*(5’ → 3’) (restriction enzyme)
Primers for mutant construction
cj0308c-F(AF) CTC
    GAATTC
CCTTTTCCATAGATGTTTGC (EcoRI)
cj0309c-R (AR) CCA
    GGTACC
AAATTTCACAGGCAGTAGCT(KpnI)
cj0310c-F (BF) GAA
    TCTAGA
GTGGGGTAATGATAGGAGTG(XbaI)
cj0311-R (BR) CCA
    GTCGAC
CAAGGGCTAAAAGATTGATA (SalI)
cj0422c-F (CF) GCC
    GAATTC
AATAAGGGTTGTAATTGAAGCG (EcoRI)
cj0423-R (CR) AAT
    GGTACC
TGCTCAAACCAATAATAGCG(KpnI)
cj0425-F (DF) TTT
    GCTAGC
GGACTA TTATTGTTTGGCTTGT (NheI)
cj0426-R (DR) ATC
    CTGCAG
GTCTAATGAGTTGGCCTGAA (PstI)
cj1168c-F(EF) AGC
    GAATTC
ACAGAACCTAAAGTCCCA (EcoRI)
cj1169c-R (ER) AATC
    GGTACC
ATCCAGAGCCAGAGTCAAA(KpnI)
cj1170c-F (FF) AAA
    TCTAGA
ATGAAAGAAGACAAGCACT(XbaI)
cj1171c-R (FR) TTG
    GCATGC
TAGAAACTGAAAAAGGCAC (SphI)
cj1172c-F (GF) ACA
    GAATTC
ACGGTGCGTGTAGGGTT (EcoRI)
cj1173-R (GR) ACT
    GGTACC
ACAATAGCAGCAATCAAGAA(KpnI)
cj1174-F (HF) GGT
    TCTAGA
GGCATCATAGGAACTTGTCT(XbaI)
cj1175c-R (HR) GGT
    CTGCAG
ATCGATGATGTAATGAAAGC (PstI)
16S-F ATCGTAGATCAGCCATGCTA
Primers for complementation construction
cj1169c-cj1170c-F TTG
    TCTAGA
AAAAGATTAAACAGTAA(XbaI)
cj1169c-cj1170c-R AAC
    TCTAGA
ACAAGGAGTTATGATTA(XbaI)
cj1173-cj1174-F TAT
    TCTAGA
CAGTGCCACCTTCTTTAGCG(XbaI)
cj1173-cj1174-R CCG
    TCTAGA
CTTTAATGGGTATTGAAGCA(XbaI)
Primers for qRT-PCR
qRT-16S-F TCCCAGTTCGGATTGTTCTC
qRT-16S-R GTACAAGACCCGGGAACGTA
cj0061-F GAAGGCAAGCGTTCTTTTAGTCT
cj0061-R AGAAAGAGCAAGATGAGCTTGTG
cj0258-F GTGAAAATGCCGATGAAAATG
cj0258-R GCGATGATGGTAGGTTTACTTTG
cj0310c-F TAGAGTGCTTTTGGGTAAGTGGA
cj0310c-R AATACAAACCCCAATGGCTGTTA
cj0345-F TATGGTGTTGTTTTGGGTTCTTC
cj0345-R CCAGCAATAGGGGCTAAATAAAT
cj0425-F CTTCAGGCCAACTCATTAGA
cj0425-R GGGCTTTAAGTCCGGATAATTC
cj0426-F AACCTTGATTTAGAGGCGATTTC
cj0426-R GCCTATCATGAGAGATGACAACC
cj0767-F ATGGTTTCCATATCTTCCCAAAG
cj0767-R TAATCCGTGGACTTAGAGCAGTG
cj1168c-F CAAGTATAGCCACCCAAATAGCA
cj1168c-R TTACCAGGGATTCGTCAGTACAT
cj1170-F CAAAATCAGTCATATGAGCCACA
cj1170-R CTATGCTGCAGTAGAAGGAGAGC
cj1173-F CTGTATGGGAGCTTTTAGGGATT
cj1173-R TCCAACGATAGAAAGAACAATGC
cj1226-F GCTTTGCTTCTGTTATCTCATCC
cj1226-R AGGCTCTTAAATTTTGCAGGAGT
cj1563-F GCAGTTTTTATACCCAAAGAGCA
cj1563-R GCGATATAGAATGGGTAAAATGG
Primers for conventional RT-PCR
cj0423-F GCGGGTCTATTTTTGTA
cj0425-R CTTGGCTATTTCCTTGA

*Underlined sequences indicate recognition site for the corresponding restriction endonuclease, which is shown in parenthesis.

Xia et al.

Xia et al. BMC Microbiology 2013 13:133   doi:10.1186/1471-2180-13-133

Open Data