Table 1

Primers employed for Real-Time PCR

Target gene

Sequence (5' to 3')

Reference or GenBank

accession no.


E. coli 16S rDNA

F

GCAGGCCTAACACATGCAAGTC

[30]


R

TGCTGCCTCCCGTAGGAGT


traD

F

ACGCCTCCTGTTCTGTTTCA

[DQ401103.1]


R

ATCAGCCCGGTCAGATTGT


virB11

F

GGATCAACTCAGCCACAAAAA

[DQ401103.1]


R

CACCGTTCCGCTGTTCTATT


virD4

F

GTTGTCCAGGGTAGCAGCAG

[DQ401103.1]


R

TGGACAACCAGGAACAAGC


dfr16

F

GACCTCATCCTCCGATGG

[AJ517790.2]


R

TGGTCGGAGATATGGGTATAGAA


C3

F

CGGACGCTGACATCTACCAA

[25]


R

TCCAGGTCTGCTCTCCCAAG


IL-1β

F

ATCAAACCCCAATCCACAGAGT

[25]


R

GGCACTGAAGACACCACGTT


IL-8

F

TGTTTTCCTGGCATTTCTGACC

[24]


R

TTTACAGTGTGGGCTTGGAGGG


TNF α

F

ACCAGGCCTTTTCTTCAGGT

[10]


R

TGCCCAGTCTGTCTCCTTCT


ef1α

F

TGCCTTCGTCCCAATTTCAG

[24]


R

TACCCTCCTTGCGCTCAATC


Cantas et al. BMC Microbiology 2012 12:37   doi:10.1186/1471-2180-12-37

Open Data