Table 1

Oligonucleotide primers pairs used in this study
Primer pairs Sequence (5'-3') PCR products (Size) Predicted products/Size (amino acid residues)
plyBt33-F/ BamHI GA
    GGATCC
*ATGGGTTACACTGTAGATATTTC
plyBt33 (816bp) PlyBt33/33kDa (amino acid residues 1–272)
plyBt33-R/ SalI GAC
    GTCGAC
TTCTTTTGTATAAAAGTATTTAA
plyBt33-F/ BamHI GA
    GGATCC
ATGGGTTACACTGTAGATATTTC
plyBt33-N (558bp) PlyBt33-N/24kDa (amino acid residues 1–186)
plyBt33-N-R/ SalI GAC
    GTCGAC
TGTAAACCAATCTAACGACT
plyBt33-IC-F/BamHI GA
    GGATCC
CTTGGATACACTTCAAAAAT
plyBt33-IC (258bp) PlyBt33-IC/11kDa (amino acid residues 187–272)
plyBt33-R/ SalI GAC
    GTCGAC
TTCTTTTGTATAAAAGTATTTAA

*The characters underline represents the restriction enzymes digest sites.

Yuan et al.

Yuan et al. BMC Microbiology 2012 12:297   doi:10.1186/1471-2180-12-297

Open Data