Table 2

Oligonucleotide primers used in this study
Primer Sequence
rt-16S-f CGTGGAGGGTCATTGGA
rt-16S-r CGTTTACGGCGTGGACTA
rt-icaA-f TTTCGGGTGTCTTCACTCTAT
rt-icaA-r CGTAGTAATACTTCGTGTCCC
rt-icaR-f ATCTAATACGCCTGAGGA
rt-icaR-r TTCTTCCACTGCTCCAA
rt-clfB-f TTTGGGATAGGCAATCATCA
rt-clfB-r TCATTTGTTGAAGCTGGCTC
rt-fnbA-f ATGATCGTTGTTGGGATG
rt-fnbA-r GCAGTTTGTGGTGCTTGT
rt-fnbB-f ACAAGTAATGGTGGGTAC
rt-fnbB-r AATAAGGATAGTATGGGT
rt-map-f AAACTACCGGCAACTCAA
rt-map-r TGTTACACCGCGTTCATC
rt-efb-f TAACATTAGCGGCAATAG
rt-efb-r CCATATTCGAATGTACCA

Yu et al.

Yu et al. BMC Microbiology 2012 12:288   doi:10.1186/1471-2180-12-288

Open Data