Table 1

Primers used in this study
Sequence (5’-3’) Target gene Reference
LuxR-A GGACTAGTTACTAATTAGGGCAA luxR null mutant This study
LuxR-B ATAAATACACAACATGAGTCGGGTGCGGGG
LuxR-C ATGTTGTGTATTTATAAAGAAGAA
LuxR-D CTCGAGCTCGAGTCAGTGGGTCTA
LuxR-G CCGGAATTCCATTTGGCAAGGATT Over expression luxR
LuxR-H CGCGGATCCGGTGATGAGTTTCAC
LuxR-1 CCATTACACTCATAAGCGCGA Sequencing luxR and
LuxR-2 TCGAGATGGGTTGTGACGCTG flanking regions
LuxRI-F2 GCACCATTACACTCAT Detection of luxR
LuxRI-R2 TTTGATGAACATGTTTTG
LuxRI-F4 AAGTGTGGTTTGAGTGGA Detection of luxR and
LuxRI-R4 TAAGCAACAGCTGATGGA flanking regions
LuxS-F6 CGATCTTGCTCTACCGGCT Sequencing luxS
LuxS-R7 GAGTGCATCGCTGCAGTAC flanking regions
LuxS-A GGACTAGTCTGGCTTATCACGAAG luxS null mutant
LuxS-B CTCATTGAGCATTCGACAGTAAAGCTATC
LuxS-C GAAATGCTCAATGAGCTTCGCGTC
LuxS-D CTCGAGCTCGGACACTCGATCCACA
LuxS-PMMBF CCGGAATTCGCCAGCAGGAGAAGGACA Over expression luxS
LuxS-PMMBR CGCGGATCCCGCTATCGATTAATCGA
LuxS-AI GGATCCGCCAGCAGGAGAAGGACA Cloning of luxS into pACYC184
LuxS-BI GTCGACCGCTATCGATTAATCGAC

Restriction sites for SpeI (ACTAGT), BamHI (GGATCC), EcoRI (GAATTC), SalI (GTCGAC) and SacI (GAGCT) are indicated in bold.

García-Aljaro et al.

García-Aljaro et al. BMC Microbiology 2012 12:287   doi:10.1186/1471-2180-12-287

Open Data