Table 1

PCR primers and conditions used in this study to verify the presence of genes associated with C. jejuni strains NCTC 11168 and RM1221 in isolates 00–2425, 00–2426, 00–2538, and 00-2544
Locus Primer Primer sequence 5' - 3'

Product

size (bp)

Annealing temperature (°C)
cj0032 F TTTAAAGGCCAAGATAGAA 512 48.3
R GCGTAAAGAAATAGCAAGTT
cj0138 F GAAGGCGGGGTAAATCT 151 46.1
R TTGCAAAATGTTCTATCTT
cje0302 F TCCTTTGATGCTTTCTAA 137 43.8
R GTCCTATACTAACTCCACTT
cj0424 F TTTGTAGTTTAATTGCGATGTTGT 346 50.1
R AGTAGTTTTCCCTTTGCTCTCA
cj0589 F ATGGGGCTTTATTAGTTATT 547 46.6
R TCGCTTGATCTTACACCT
cj0628 F ATCAAAACAATTCGGCAACTT 455 51.5
R ACTTCGATTCAATATACCAACACC
cj0780 F TGGCGTTAAAGCGGGTGATA 492 52.8
R CCTGGTTTTGGGTTGATAGTCTT
cj1158 F TTTAAACATATCATAAGCACCTTTTT 107 46.0
R GCTATTACTTCTCCCGTGATTTAT
cj1202 F ATCAAAAATCTTCATGCTATCTTA 434 48.8
R TTATCTGTTCCTGCATTTACCTTA
cj1218 F AATTCTTTCGACTTCTTCC 317 46.6
R ATTTTATCGGCACACTTGA

cj1318/

cj1336

F GGAGGAAATGGAAAAGTTGAA 477 48.2
R AAATTGAGTACGCAGAGGTTGT
cj1333 F TTTTGGGGAATTTGATAAGGA 460 44.6
R ACAGTTGTAGGTGGTAATA
cj1463 F AAAGCCTTAAAAGAACAAACCAA 174 48.8
R TGAAAAACCCATACCTCCACTTA
cj1622 F ACGCCTTACATGAGTTTAT 438 48.4
R TAGGGCAATCTTTTCTTATG
cj1729 F CCATCTGCCGTTACTACTACTTTT 441 52.2
R ACAGGCTGGAACACCGACTATTA

The “cj” locus designations refer to genes present in NCTC 11168, while the “cje” locus designation refers to a gene in RM1221.

Clark et al.

Clark et al. BMC Microbiology 2012 12:269   doi:10.1186/1471-2180-12-269

Open Data