Table 2

Sequences of the Primers used in this study
Primer Sequence (5’-3’) Reference
Forward Reverse
cesD GTTTATCAAATCATGAAGATGCACAA GCCCTGGGATCTTGCATAAC [23]
escJ CCAATGATGTCAATGTTTCCAAA GCGCGAACAAAATCCTCTTT [23]
escR GCCAGCCTCCAACAAGAATG ATTGGCCTTGGGTATGATGATG [23]
escU TCCACTTTGTATCTCGGAATGAAG CAAGGATACTGATGGTAACCCTGAA [23]
flhC CGCTTTCCAGCATCTGCAA CGGGATATTCAGCTGGCAAT [23]
flhD TCATTCAGCAAGCGTGTTGAG TCCCGCGTTGACGATCTC [23]
ler CGACCAGGTCTGCCCTTCT TCGCTCGCCGGAACTC [23]
sepZ CGGAGACGAGCAGCACAGA CCGCCAACCGCAGTAAGA [23]
stx2 ACCCCACCGGGCAGTT GTCAAAACGCGCCTGATAGAC [23]
rpoA GTTGCCGCACGACGAATCGC CCCAATCGGCCGTCTGCTGG This study
qseC CAGTCCACAGGGCAGCGTGG AGTCCACTGCCGGTAGCGGT This study
qseB GAGCTGCGCCACGGTAACGT AGTTTGCGCGGCAGTACCCG This study
qseA CCAGCCCCCGACCTGATTGC GCGGGATCAGGCGAGTCGAG This study
qseB(cloning) GTGCTGTACA
    GAGCTC
GTTACAAC
CCAGGCGACA
    AAGCTT
GAAAGCA
This study
qseC(cloning) TGCGTCTGG
    GAGCTC
ACGATTATC
GGTGAGACGTTT
    GTCGAC
TATAGTACG
This study

The underlined segment in AV25/26 and AV29/30 indicate the restriction enzyme sites.

Vikram et al.

Vikram et al. BMC Microbiology 2012 12:261   doi:10.1186/1471-2180-12-261

Open Data