Table 1

Primers used in this study
Primer names Primer sequences (5-3) Amplicons (bp) References
16S RNA-F AACCTTACCTGGGCTTGATA
16S RNA-R CTTAACCCAACATCTCACGA 122 [34]
ciaB-F ATATTTGCTAGCAGCGAAGAG
ciaB-R GATGTCCCACTTGTAAAGGTG 157 [34]
dnaJ-F AGTGTCGAGCTTAATATCCC
dna-R GGCGATGATCTTAACATACA 117 [34]
htrA-F CCATTGCGATATACCCAAACTT
htrA-R CTGGTTTCCAAGAGGGTGAT 130 This study

Bui et al.

Bui et al. BMC Microbiology 2012 12:232   doi:10.1186/1471-2180-12-232

Open Data