Table 1

Oligonucleotide primers used in this study
Application Name Oligonucleotide sequence (5’ to 3’)
Strain construction PKD13sspAUS2 ACTATCATCCAATTTTCTGCCCAAATGTCGGGTATTGCTCAGGAGGTTTCTTTCATGATGTCCGGGGATCCGTCGACCTGC
PKD13sspADS AGATTAACTCCGGCCCAGACGCATTTCACGTTCTGCTTCAGTGTAGGCTGGAGCTGCTTCGA
sspABUS GATTGGATCCGGCTTCGTTACTCGTGACGCT
sspABDS GATTGAAGCTTACTTCACAACGCGTAATGC
hnsΔ92-1 GAGCTGCTGAATAGCCTTGCCGCCGTTAAATCTGGCACCAAAGCTAAACGTGCTTGTGTAGGCTGGAGCTGCTTCG
hnsΔ92-2 GGTTTTAGTTTCGCCGTTTTCGTCAACGTAGCTATATTTTGCCGGACGCTTATGAATATCCTCCTTAGTTC
hnsUS2 CCATGGAATTCACCATGAGCGAAGCACTTAAAATTCTGAACA
hnsDS2 CCAGGTCTGCAGTTATTGCTTGATCAGGAAATCG
Plasmid construction lerUS2 GATTGGATCCGCTGCGACTGCGTTCGCTTGCT
lerDS2 GATTGAAGCTTCCAGCTCAGTTATCGTTAT
Primer extension lerPE GCTTCCTGCTGTAGA
LEE2PE GCTGCTTCCATTGATCTTTCTCC
LEE3PE CAATTTCAACACGGTTATC
LEE4PE CAGATGCGGGGTTTTGATTAAATTC
LEE5PE CATTGGGATTATGACCAAGA
mapPE GGACTAAACATGCTATAAACC
grlRPE CCTTCCCCACAGGAGTCTTC
stcEPE GGCAAGGATCGTACATGA
ompAPE ACGAGATAACACGGTTAAATCC

Hansen and Jin

Hansen and Jin BMC Microbiology 2012 12:231   doi:10.1186/1471-2180-12-231

Open Data