Table 2

Oligonucleotides used in this study

Primer

Function*

Sequence (5' to 3')


TDC11

RT1

tyrS probe amplification (F)

tyrS probe amplification (R)

TCAATTACAGATCGGTGGGG

ACTTACCATCGAATGCATCAAATG

TRNA2B(2)

TRNA(P)

TyrS prom (F)

tyrS prom (R)

mRNA-C quantification (F)

mRNA-C quantification (R)

mRNA-L quantification (F)

mRNA-L quantification (R)

CGTAAATTAGAAGGGCCAGAGGCAG

GATCAAGCCAGATTGCGCCACCTGCAG

AACAGGCAATGATCAAAACGAAGTA

CATAGGCTCCTAAAATGTAATTCGC

TYR2

PtyrS mapping (R)

ACTTCGTTTTGATCATTGCCTG

TDC123

TDC130

PtyrSΔ cloning and sequencing (F)

PtyrSΔ cloning and sequencing (R)

AAAACTTCCCATATGCATTGTAACG

CTGCAGCATTTTATATGTTTTGTAGTAA

TYS (F)

TYS(R)

tyrS overexpression (F)

tyrS overexpression (R)

ATGGGTGGTGGATTTGCTAATATTATCGATGAATTAACTT

TTGGAAGTATAAATTTTCATCAACTACTTTGGCCAAAAAG


*F, forward; R, reverse

Linares et al. BMC Microbiology 2012 12:23   doi:10.1186/1471-2180-12-23

Open Data