Table 2

Primer sequences
Name Sequence 5- 3a Reference and characteristics
opeF TAAGGAGAAGCAACATGCAAGA This work. RT-PCR of dksA operon from nucleotide +40 to +1477b
opeR ATAGCTCAGCATGACGCATTT
dksAF ATGCAAGAAGGGCAAAACCG This work. RT-PCR of dksA gene from nucleotide +54 to +488
dksAR GCGAATTTCAGCCAGCGTTT
interF AGTGGAAGACGAAGATTTCG This work, RT-PCR of intergenic region from nucleotide +368 to +863
interR TCCTTGTTCATGTAACCAGG
gQRSF TTCAAAGAGATGACAGACACACAG This work, RT-PCR of gluQ-rs gene from nucleotide +567 to +1074
gQRSR CACGGCGATGAATGATAAAATC
rrsHF CCTACGGGAGGCAGCAG [40] RT-PCR of ribosomal RNA 16S
rrsHR CCCCCGTCAATTCCTTTGAGTTT
pcnBR GATGGAGCCGAAAATGTTGT Reverse of pcnB gene from nucleotide +1993
PdksAF GGATCCAAGCGAAGTAAAATACGG BamHI site, from nucleotide −506
PdksARST AAGCTTGTGATGGAACGGCTGTAAT HindIII site, to nucleotide +527
PdksARCT AAGCTTCTGTGTGTCTGTCATCTCTTTG HindIII site, to nucleotide +590
PgluQF GGATCCAAGAAGGGCAAAACCGTA BamHI site, from nucleotide +58
TERGQ2 CCTTATTTTTTGTTCAAAGAGATGACAGACACACAGA Recognition from nucleotide +555
TERMGQ3 ATAAGGCGGGAGCAT
    AA
C
    GGAGGA
GTGGTAAAC
Recognition from nucleotide +560, underline sequence are nucleotides changed
M13R GCGGATAACAATTTCACACAGG Recognition site in pTZ57R/T
ATGGQRSF GGATCCG
    TAA
TTACAGCCGTTCCATC
BamHI site, from nucleotide +507. Underline nucleotides correspond to the stop codon of dksA
ATGGQRSR CTCGAGGCATGACGCATTTGAGAATG XhoI site, to nucleotide +1469
virFF AGCTCAGGCAATGAAACTTTGAC [41]
virFR TGGGCTTGATATTCCGATAAGTC

aNucleotides in bold are indicated restriction site.

bFragments cloned are indicated based on the transcription start of dksA identified by [25].

Caballero et al.

Caballero et al. BMC Microbiology 2012 12:226   doi:10.1186/1471-2180-12-226

Open Data