Table 4

Primer sequences
Primer Sequence (5′-3′) Amplicon (bp) Cycling conditions Reference
Multiplex PCR:
LES1nestF tttggtgatgatcggcttagc 289 95°C, 4 min then 30 cycles: 95°C, 30 s; 58°C, 30 s; 72°C, 30 s; final extension step, 72°C, 7 min; [25]
LES1nestR tgtggaagcgatcagtct
Clust6nestF ggatcgacgtggcataatctg 410 [25]
Clust6nestR acgattctccggcatgcagcg
4tot1F gctcatgagtggctgacaac 105 This study
4tot1R tcttgggcagagaaccattc
Q-PCR:
2pro3F caagccctgtctggattttc 102 95°C, 10 min; then 40 cycles: 95°C, 10 s; 60°C, 15 s; 72°C s. This study
2pro3R gagacaggttgggagggagt
3tot1F cgcaggtaccaccagacttt 122 This study
3tot1R catgtccagcaggttcaaaa
3pro3F gcggatgttctcaaacgaat 134 This study
3pro3R cgggagaagcaatgacctac
4tot1F gctcatgagtggctgacaac 105 This study
4tot1R tcttgggcagagaaccattc
4pro3F tcgtgctgtgctgatctttt 172 This study
4pro3R agcagtgccagttgatgttg
Preparation of DIG-labeled probes:
φ2intDIGF tgcctatctaacggggttca 1097 95°C, 4 min. 30 cycles: 95°C, 30 s; 55°C, 30 s; 72°C, 1 min s; final extension step, 72°C, 7 min This study
φ2intDIGR gaagcaaccgagaagtggag
φ3intDIGF ggatcatgtagcgggaaaga 874 This study
φ3intDIGR agaacctggcgaaagtctga
φ4cIDIGF atcgttaattggcacggaat 893 This study
φ4cIDIGR acagcaacggatttccactc

tot = to quantify total phage copies; pro = to quantify total phage copies.

James et al.

James et al. BMC Microbiology 2012 12:216   doi:10.1186/1471-2180-12-216

Open Data