Table 1

Capillary electrophoresis Universal-tailed Mismatch Amplification mutation assays for genotyping single nucleotide polymorphisms inBrucellaisolates
SNP assay Allelic Primer1 Allelic Primer2 Consensus Primer Amplicon Size Dye Set Allele SNP position in 16 M Branch
2366 CACGGCCTATCTGCTGGGCT CACGGCCTATCTGCTGGGAC GAGCGTCGTGAAGTCGGTTAC 151 NED/PET T/C 1173417 A
4748 ACAGTCAGACAAGGACCGGA AACAGTCAGACAAGGACCGAC GTAACAAGAACACGGCCTTTACGC 155 FAM/VIC C/A 1744207 B
1562 CACGCAAAATAGCTAAATGAAATATAC ACGCAAAATAGCTAAATGAAATATTG GATGGCTTTCCGGGGCTATC 189 NED/PET C/G 1405281 B
2922 TAAAGACGGCGATTACCGAG GTAAAGACGGCGATTACCGTA GACAACGCCAACGGCATTCTT 179-180 NED/PET G/A 413931 C
991 CAGTATGAAGCTTATTTTAAGCCA GCAGTATGAAGCTTATTTTAAGCAG GTATGCTCAAGCGCCAAGCTG 195 FAM/VIC G/A 1601481 C
3740 CGGAATACGAAAACTCACATTATAG CGGAATACGAAAACTCACATTATTA GCGGGGCCATAGGGAAATAC 133 VIC/FAM G/A 675905 D
1344 ACACGGTTGGAATTATCCACT ACACGGTTGGAATTATCCATC GACCGGCAAGCTTGAATCG 171 FAM/VIC C/T 1392400 D
5754 GCTGGAACATATAGAAAAGATCATAAAAG GCTGGAACATATAGAAAAGATCATAAATA GCAGCCTTCCAAGGAAAAGAACG 117 VIC/FAM G/A 1083478 E
1522 GGTGAACATTTCGCCATCAG GGTGAACATTTCGCCATCTA GTTCGATGAACCTCGTGGCATT 123-124 NED/PET G/A 497534 E
6214 ATTGAATGATGAGCGATATTGTG TGAATGATGAGCGATATTGCA GAGCGCTTGTCGGAGGTTGTT 110-112 PET/NED A/G 242224 F
2995 CGAAACAGCTGAGAAGATCGAG AAACAGCTGAGAAGATCGGC GTTAGAAGCCTGGCCCGTTCTC 101 VIC/FAM G/C 478183 G
8872 GCATCGAACTCATTCTCGCT GCATCGAACTCATTCTCGTC GCGAAATCAAGGCCCCATTTG 160 PET/NED C/T 1170581 G
1688 CGATCTGCCAGTTGACGAGA CGATCTGCCAGTTGACGATT GTGCAACGCCTCACGCATAAT 181 FAM/VIC T/A 1348434 H
5362 ATTACCACGCACCGATGAGA ATTACCACGCACCGATGAAG GCATCCATGACGGCGTGAAAC 240 FAM/VIC G/A 507275 I
8306 CACGGTTGCATGGTTTGTATATA ACGGTTGCATGGTTTGTATAAG GAGCACCAAACCGGGTGATGT 259 FAM/VIC G/A 1876820 I
10621 TATGCAATTCGTGTCGCATG TATGCAATTCGTGTCGCAGA GTTTCAGGACTTTTGGGAACTGACC 233 NED/PET G/A 1207543 J
10621R GGTAATTTTTCCGCTTGCGT CGGTAATTTTTCCGCTTGCTC GCACGGGCGCAGGCTCTTAT 250 PET/NED C/T 1207539 J

First allele is the ancestral SNP state and has a VIC or NED dye; second allele is derived and has a FAM or PET dye. Universal tails were added to the 5' end of the allelic primers during primer synthesis. See Figures 1 and S1 for branch location of SNPs in phylogeny. SNP positions are given for B. melitensis 16 M genome and all are on chromosome I except assays 6214 and 2995 are on chromosome II.

Foster et al.

Foster et al. BMC Microbiology 2012 12:110   doi:10.1186/1471-2180-12-110

Open Data