Table 2

Oligonucleotides used for site directed mutagenesis, and overexpression
Oligonucleotide Sequence Description or reference
pbrR C14S 5’ CCA CCG GG
    G
ATG CGG TGC 3’
PbrR mutagenesis primer
pbrR C55S 5’ CCA GAG ACC GG
    G
AGT GAC G 3’
PbrR mutagenesis primer
pbrR C79S 5’ GAC TTC ACC G
    G
A ATC CTG G 3’
PbrR mutagenesis primer
pbrR C114S 5’ GGC ACC AGA A
    G
A GGC TTC G 3’
PbrR mutagenesis primer
pbrR C123S 5’ GCA GAA TCC CG
    G
ACG ATT G 3’
PbrR mutagenesis primer
pbrR C132S 5’ CGT ATC ACA CAC G
    G
A GTC CGA C 3’
PbrR mutagenesis primer
pbrR C134S 5’ CGT ATC A
    G
A CAC GCA GTC CGA C 3’
PbrR mutagenesis primer
pbrR C132S/C134S 5’ CGT ATC A
    G
A CAC G
    G
A GTC CGA C 3’
PbrR mutagenesis primer
pbrApe 5’ GCG CCA ACC GTG CTC GGT TCT GGG 3’ Primer extension/sequencing primer [4]
pbrBstEII 5’ GCG AAT GGT CAC CAC CGG 3’ Primer to amplify PpbrA
pbrNruI 5’ GCT TGT CGC GAA TCA GCG 3’ Primer to amplify PpbrA
pMU forward 5’ GAT TCT CCC CAC ATC ACC AG 3’ Sequencing primer for pMU2385
pMU reverse 5’ TGC CAG CAT TTC ATA ACC AA 3’ Sequencing primer for pMU2385
M13-F 5’ CGC CAG GGT TTT CCC AGT CAC GAC 3’ Sequencing primer for pUK plasmids
M13-R 5’ GAG CGG ATA ACA ATT TCA CAC AGG 3’ Sequencing primer for pUK plasmids
conpbr: 5’ CTAGAGGGTTAATCGGCAAC 3’ PpbrA mutagenesis primer
merpbr: 5’ CTAGAGGGTGTAAGGTCGGCAAC 3’ PpbrA mutagenesis primer
-1EcoPbr 5’ GGG GAA TTC GAA GCT TGC T 3’ (3’ primer) PpbrA mutagenesis primer
-1CentreBam 5’ GCC GAT TTA AAC CCT CTA GT 3’ (primer B) PpbrA mutagenesis primer
-1CentreEco 5’ CGG CTA AAT TTG GGA GAT CA 3’ (primer A) PpbrA mutagenesis primer
-1BamPbr 5’ CAG TAT ACC TAG GCA GCT GG 3’ (5’ primer) PpbrA mutagenesis primer
pbrR ATG (LIC) 5’ GAC GAC GAC AAG ATG AAT ATC CAG ATC GGC GAG C 3’ PbrR cloning and overexpression primer
pbrR TAG (LIC) 5’ GAG GAG AAG CCC GGT CTA GTC GCT TGG ATG GGC 3’ PbrR cloning and overexpression primer
T7 terminator 5’ CGA TCA ATA ACG AGT CGC C 3’ Sequencing primer

Underlined bases highlight alteration from the wild-type sequence.

Hobman et al.

Hobman et al. BMC Microbiology 2012 12:109   doi:10.1186/1471-2180-12-109

Open Data