Table 2

Primers used in this study

Primer

Sequence


YPTB1572Lux1

TTTCCCGGGCACCTTGGCTGCACCGACTTC

YPTB1572Lux2

TTTGGTACCCGATAGAGACTCATACTTACC

YPTB1668Lux1

TTTCCCGGGCATTTTGGGTGAACACAGAGG

YPTB1668Lux2

TTTGGTACCGAGAAACTCACTGATTGGCTG

YptbIntMBP-1

TCAGAATTCATTAGTGAAGTCACCCCAAC

YptbIntMBP-2

TCATCTAGATGTGCCAGAGCCCTCCTAACC

YptbIntMBP-3

TCATCTAGATTTATTTTAT

    ACC
CATGTAAAGC

INTPROM3

TTTGGTACCTCAATTACATATCGTTAACGC

INTPROM4

TTTGCATGCGATCTGTCTAAAGAGCGTCG

INTA

TTTGCATGCTGGAGTATAGGTAAGTATGAG

INTB

TTTGAGCTCGTTTGCACATCGGCTAATGG

YPTB1668Chlor1

CAGGTCCAGCCTTATTCTGTCTCTTCATCTGCATTTGAAAATCTCCATCCTCACTTATTCAGGCGTAGCAC

YPTB1668Chlor4

CGTTCTCCAATGTACGTATCCCGACGCCAAGGTTAAGTGTGTTGCGGCTGCATAGTAAGCCAGTATACACTC


Restriction sites are in bold and position of mutated cysteine to glycine residue is underlined.

Strong et al. BMC Microbiology 2011 11:85   doi:10.1186/1471-2180-11-85

Open Data