Table 1

Primer pairs and probes used in this study

Primers/probes

Sequence

1Orientation

Reference


For cloning p28-Omp14 and p28-Omp19 promoters into pMT504


RRG217 (p28-Omp14)

5"-ttgctcaaccataaaataatggga

F

25


RRG695 (p28-Omp14)

5"-taaaaatttaagaataatgaaag

R

This study


RRG185 (p28-Omp19)*#

5"-GACTCTAGActtttaattttattattgccacatg

F

25


RRG696 (p28-Omp19)

5"-aaataaattaacaatagtagaag

R

This study


For cloning RpoD gene into pET32


RRG742*

5"-GAGCCATGGcttaacaaattctatattttccctaactc

F

This study


RRG743*

5"-CGCTCGAGttaactattgatattacaatgacctagt

R

This study


For TaqMan RT-PCR of test G-less transcripts


RRG766

5"-ccttcctccatctataccac

F

This study


RRG767

5"-gagagtgaatgatgatagatttg

R

This study


RRG765 (TaqMan Probe)

5"-cattattcctcctatcttctcctcttctc

This study


For TaqMan RT-PCR of control G-less transcripts


RRG769

5"-tactcacccaatactcccta

F

This study


RRG770

5"-gtggaatgagaaatgagtgt

R

This study


RRG768 (TaqMan Probe)

5"-cttatcctctcctcacctctccctc

This study


For sequencing pRG198


M13F-40

5"-gttttcccagtcacgac

Commercial


p28-Omp14 promoter EMSA probes


Full length probe


RRG 217**

F


RRG 218

5' gttaataaaccttttataaaag

R

25


Probe 1 (P1)


RRG217**

F


RRG623

5"-ggtttagccattttaaatgtg

R

This study


Probe 2 (P2)


RRG267

5"-cagttaactttctgtaaacttc

F

25


RRG623

5"-ggtttagccattttaaatgtg

R

This study


Probe 3 (P3)


RRG269

5"-cgttttctgctttattagaatg

F

25


RRG625

5"-gtacatgcattatgagcaaatc

R

This study


Probe 4 (P4)


RRG270

5"-gttccgtatttattaatatatg

F

25


RRG626

5"-ctatacttaactttactactta

R

This study


Probe 5 (P5)


RRG272

5"-ggataagtactttagcaagtgg

F

25


RRG627

5"-gtctagaatataaaatttctttc

R

This study


p28-Omp19 promoter EMSA probes


Full length probe


RRG 185**

F

25


RRG 445

5' atataacctaatagtgacaaataaattaac

R

This study


Probe 6 (P6)


RRG185**

F

25


RRG628

5"-gcacttataaactagtccc

R

This study


Probe 7 (P7)


RRG276

5"-gtgctgtttttctcacctttacac

F

25


RRG629

5"-cttttgtaaggaaaatttaatata

R

This study


1F, forward primer; R, reverse primer

* Text in capital letters refers to sequences inserted for creating restriction enzyme sites

#Text in bold and italics letters refers to 7 nucleotides of coding sequence from the 3" end of p28-Omp18 gene used in the primer

** Primer sequences were presented only once when a primer was described for the first time.

Faburay et al. BMC Microbiology 2011 11:83   doi:10.1186/1471-2180-11-83

Open Data