Table 2

Genomic region, primers, and melting temperatures for all genes investigated

Gene

Annotation

Primer

Sequence (5' - 3')

Ta

Size


Housekeeping Genes


16S rRNA

16S ribosomal subunit

16S-For

CTGAGAATTTGATCTTGG

52°C

1549 bp

16S-Rev

AAAGGAGGTGATCCAGC


16S/23S

16S-23S intergenic spacer

Spacer-For

AAGGATAAGGAAAGCTATCA

54°C

225 bp

intergenic spacer

Spacer-Rev

AATTTTTGATCCATGCAAGA


Membrane Proteins


ompA

Outer membrane protein A

1

ompA-For

ATGAAAAAACTCTTAAAATCGG

56°C

1170 bp

ompA-Rev

TTAGAATCTGCATTGAGCAG


2

MJFvd3a

GGITG(CT)GCAACTTTAGGIGC

50°C

457 bp

MJRvd4a

CACAAGCTTTTCTGGACTTC


3

CpeNTVD3b

GTTCTTTCTAACGTAGC

46°C

359 bp

CpeNTVD4b

TGAAGAGAAACAATTTG


omcB

Cysteine-rich outer

omcB-For

ATGACCAAACTCATCAGAC

54°C

1675 bp

membrane protein B

omcB-Rev

TTAATACACGTGGGTGTTTT


pmpD

Polymorphic membrane

pmpD-For

ATGATCAGTCATATACGGAC

56°C

4145 bp

protein D

pmpD-Rev

TTAGAAAATCACGCGTACG


incA

Inclusion membrane

incA-S-Fc

TATCGTAATACCAAACCACT

52°C

984 bp

protein A

incA-S-Rc

GTGTGAGATGGCTCTTTATG


copN

Chlamydia outer protein N

copN-For

ATGGCAGCTGGAGGGAC

56°C

1191 bp

copN-Rev

TTATGACCAGGGATAAGGTT


Potential Virulence Genes


tarP

Translocated actin-recruiting phosphoprotein

1

tarP-For

ATGACCTCTCCTATTAATGG

56°C

2604 bp

tarP-Rev

CTAGTTAAAATTATCTAAGGTTT


2

tarP-2-For

AAGAACCAACTCTGCATTATGAAGAGG

54°C

768 bp

tarP-2-Rev

AAGAGGTATTCACGCGACTTCCG


MACPF

Membrane-attack

MAC-For

TTGGCGATTCCTTTTGAAGC

58°C

2346 bp

complex/perforin protein

MAC-Rev

TTATAAGCACACACTAGGTCT


ORF663

Hypothetical protein

663-Fc

AAACAACTGCACCGCTCTCT

55°C

1167 bp

663-Rc

GAAGGACTTTCTGGGGGAAG


1primers used for initial sequencing of full-length gene from MC/MarsBar/UGT type strain; 2/3 primers used for second-stage sequencing from koala populations for further analysis; aprimers designed by [7]; bprimers designed by [10]; cprimers designed by [26].

Marsh et al. BMC Microbiology 2011 11:77   doi:10.1186/1471-2180-11-77

Open Data