Table 1

Specifications of the 16S rRNA primers used in this study

Target group (variable region)

Primer designation

Primer sequence (5'-3')

Amplicon size

Annealing temperature

DGGE gradient

Reference


Universal (V3)

F357-GC a

518R

TACGGGAGGCAGCAG

ATTACCGCGGCTGCTGG

217

55°C

20-70%

Muyzer et al., 1993

Universal (V6-V8)

U968F-GC a

L1401-R

AACGCGAAGAACCTTAC

CGGTGTGTACAAGACCC

489

55°C

20-70%

Zoetendal et al., 1998

Bacteroides fragilis subgroup

Bfra 531F

Bfra 766R-GCa

ATACGGAGGATCCGAGCGTTA

CTGTTTGATACCCACACT

293

65°C

20-70%

Vanhoutte et al., 2006

Bifidobacterium

g-Bifid F

g-Bifid R-GCa

CTCCTGGAAACGGGTGG

GGTGTTCTTCCCGATATCTACA

596

65°C

40-70%

Matsukiu et al., 2002

Lactobacillus groupb

Lac 1

Lac2-GC a

AGCAGTAGGGAATCTTCCA

ATTYCACCGCTACACATG

380

61°C

35-60%

Walter et al., 2001


a Primers with GC clamp at 5' end: CGCCCGCCGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCCC.

b Lactobacillus group comprising the genera Lactobacillus, Leuconostoc, Pediococcus and Weisella.

Vael et al. BMC Microbiology 2011 11:68   doi:10.1186/1471-2180-11-68

Open Data