Table 2

Primers used in this study.

Name

Sequence (5'-3')


1

EF2890 delF

CAAACTGCTCCTTCAGCAACT


2

EF2890 OEL

    ACTAGCGCGGCCGCTTGCTCC
CTATTTTGTCAGCGCCTCAAC


3

EF2890 OER

    GGAGCAAGCGGCCGCGCTAGT
TAGAAGTCGCTACCCCACTCA


4

EF2890 delR

GCGCGACAGTTACCAGAGTAT


Theilacker et al. BMC Microbiology 2011 11:67   doi:10.1186/1471-2180-11-67

Open Data