Table 1

PCR primers used in this study

A. Primers used for detection of multiple RD2 genes, Q-PCR and tiling.


Primer name

Primer sequence

Source


emm sequencing


CDC emm1

TATT(C/G)GCTTAGAAAATTAA

[19]


CDC emm2

GCAAGTTCTTCAGCTTGTTT

[19]


Detection of circular form


#1

GAAAACAAAAGTTTCTTCATGCGTTTGGCG

this work


#2

CAATTAATAGAAACATATGGTCATTTG

this work


#3

GGAATTAGCCCACTAGAATATAAGC

this work


#4

TAGCAAGTAAACCCTAGATTGTCTATGTTC

this work


Detection of genes encoding extracellular RD2 proteins


M28_Spy1306F

ACTAAGCCAAGCGAGGACAA

[1]


M28_Spy1306R

CCAAAACCGTGTAGCCTGTA

[1]


M28_Spy 1307F

TCATCGTCAAAAGCCATCTC

[1]


M28_Spy 1307R

TTGCTCTGATAAACCTCAAG

[1]


M28_Spy1308F

TACGACAGAAGCAGGTGGAG

[1]


M28_Spy1308R

ACCGAGTTTCGCAGGATTG

[1]


M28_Spy1325F

TGAATGATGCGGGGACTTAT

[1]


M28_Spy1325R

TGTAAAAGGCTGCTGGGTCT

[1]


M28_Spy1326F

ACACCGACTGAGATTGCTGA

[1]


M28_Spy1326R

TTGGCTTGTGAGGTTTGAGA

[1]


M28_Spy1332F

ATGCCAAAAACCAAAGGAAG

[1]


M28_Spy1332R

TCATACTTTTCAGGTACACAAGCA

[1]


M28_Spy1336F

GATACTTCACAGACGAAACAACG

[1]


M28_Spy1336R

ATCACGACTCCCATCACTCC

[1]


Quantitative PCR (Taqman)


proS_F

TGAGTTTATTATGAAAGAGGCTATAGTTTC

[15]


proS_R

AATAGCTTCGTAAGCTTGACGATAAT

[15]


proS_P

TCGTAGGTCACATCTAATCTTCATAGTTG

[15]


M28_Spy1306 F

CGTTGTTCCTGCTACTGGATCTGCTAC

this work


M28_Spy1306 P

ACGATTGCAAGTATTGCTTTG

this work


M28_Spy1306 R

CAATCGGTGTCGTTGGTTG

this work


M28_Spy1325 F

ACCGTCGCAAGGACCTTGTCTTTCTG

[8]


M28_Spy1325 P

CAGCATACGCATGACCTC

[8]


M28_Spy1325 R

AGTGATAACACTACCATCTGATAAAG

[8]


M28_Spy1336 F

ACAGAAGCTGCACCAAACTTGAACTTCTTAATTGA

this work


M28_Spy1336 P

GTAGATGCAGCAACTATTGAC

this work


M28_Spy1336 R

ATGATACTTCACAGACGAAACAAC

this work


M28_Spy0784_RD0 F

AGCAGAGTATGAAGGCGGTTTT

this work


M28_Spy0784_RD0 P

ATATTCTATCTGAAACGGCTCG

this work


M28_Spy0784_RD0 R

AACATCTCTGCGAGTCGTTCTATACTT

this work


M28_Spy0980_6180.1 F

TCGTTAGGACTGGCGGTAGAG

this work


M28_Spy0980_6180.1 P

TGCAACTGCTGTCTTAA

this work


M28_Spy0980_6180.1 R

AACAGTCTTTGCCACCACCAT

this work


M28_Spy1087_RD1 F

TGTTTTTTGAATCTCTGACTTCTTTCC

this work


M28_Spy1087_RD1 P

AGAATTGCAGCTACTTGTATT

this work


M28_Spy1087_RD1 R

TGCAGACGAAAATAGCTGTAACTACTC

this work


M28_Spy1231_6180.2 F

GCAGTTGCTTGTTGCGTTGA

this work


M28_Spy1231_6180.2 P

TGCAACCCACTGATTT

this work


M28_Spy1231_6180.2 R

GCGCGTAGAGCTGGAGTCA

this work


M28_Spy1805_6180.3 F

AAAGGGCTATGGACGAACGA

this work


M28_Spy1805_6180.3 P

CAGACCAGCCTTTG

this work


M28_Spy1805_6180.3 R

GGTAAACCGATATTTTTCATCAATGA

this work


B. Primer combinations used for tiling across RD2 element, after [1].


Tiling fragment

Amplified region

Primer sequence


1

M28_Spy1299-1304

GGTTTCGACAAGGTCAGAGC


TGTGAGTGTTCCTGTACCAGATG


2

M28_Spy1304-1306

ACGGCTACCTTTCCCCCTA


ACTAAGCCAAGCGAGGACAA


3

M28_Spy1306-1307

CCAAAACCGTGTAGCCTGTA


TCATCGTCAAAAGCCATCTC


4

M28_Spy1307-1308

TTGCTCTGATAAACCTCAAG


TACGACAGAAGCAGGTGGAG


5

M28_Spy1308-1310

ACCGAGTTTCGCAGGATTG


GCTTGGAGGTGTTTCCTTTC


6

M28_Spy1310-1314

CCTTGTTCTGCTTGATGTCC


ATCAAGCAAGCAACAAAACG


7

M28_Spy1314-1322

TTTCCACCCATCAGTTCAGG


GACTGGTGGCGGTAAGACTG


8

M28_Spy1322-1325

TTTCATCCCCAAAAAGCATC


TGAATGATGCGGGGACTTAT


9

M28_Spy1325-1326

TGTAAAAGGCTGCTGGGTCT


ACACCGACTGAGATTGCTGA


10

M28_Spy1326-1331

TTGGCTTGTGAGGTTTGAGA


TCATACTTTTCAGGTACACAAGCA


11

M28_Spy1331-1336

ATGCCAAAAACCAAAGGAAG


GATACTTCACAGACGAAACAACG


12

M28_Spy1336-1338

ATCACGACTCCCATCACTCC

CAAAGTTCCTGCCCCAAC


Sitkiewicz et al. BMC Microbiology 2011 11:65   doi:10.1186/1471-2180-11-65

Open Data