Table 5

Primers and adaptors used in this study.

Targeta

Primer/Adaptor

Sequence (5' to 3')

Size (bp)

Reference


--

Bgl II adaptor1

CGGACTAGAGTACACTGTC

--

[38]

--

Bgl II adaptor2

GATCGACAGTGTACTCTAGTC

--

[38]

--

Csp6 I adaptor1

AATTCCAAGAGCTCTCCAGTAC

--

[38]

--

Csp6 I adaptor2

TAGTACTGGAGAGCTCTTGG

--

[38]

--

BLG2F-0

6-fam-GAGTACACTGTCGATCT

--

[38]

--

CSP61-A

GAGCTCTCCAGTACTACA

--

[38]

Universal 16S rRNA gene

UNI27F

AGAGTTTGATCCTGGCTCAG

--

[37]

UNI338F

ACTCCTACGGGAGGCAG

--

[37]

UNI1100R

AGGGTTGCGCTCGTTG

--

[37]

UNI1492R

TACGG(C/T)TACCTTGTTACGACT

--

[37]

C. concisus 23S rRNA gene

MUC1 (forward)

ATGAGTAGCGATAATTGGG

--

[11]

CON1 (reverse)

CAGTATCGGCAATTCGCT

306

[11]

CON2 (reverse)

GACAGTATCAAGGATTTACG

308

[11]

C. concisus cpn gene

(primary primers)

Ccon-cpn_66f

TATCGAAGTGAAACGTGGCA

357

[35]

Ccon_cpn_423r

GCTCAAGCACTGGCAATAAG

--

[35]

C. concisus cpn gene

(nested primers)

Ccon_cpn_72f

AGTGAAACGTGGCATGGATA

270

[35]

Ccon_cpn_342r

GCATCTTTTCAGGGTTTGTG

--

[35]

C. concisus S-layer RTX gene

(YP_001465940.1)

FCCC13826_1838

ACAGGCCATAAGTGGATTGC

374

This study

RCCC13826_1838

CCGTCATAGTGGGCTCTCAT

--

This study

C. concisus zot gene

(YP_001467422)

FCCC13826_2075

TGCAAACCCTTTGTGATGAA

355

This study

RCCC13826_2075

CATGAGCCAGCTCAATCAAC

--

This study

Human interleukin 8 gene

(NM_000584)

hIL-8f

TTTTGCCAAGGAGTGCTAAAGA

194

PB b

hIL-8r

AACCCTCTGCACCCAGTTTTC

--

PB b

Human C1orf33 gene

(NM_016183)

hC1orf33f

TCCAAGCGCGACAAGAAAGT

102

PB b

hC1orf33r

GTAGGTGTCCACACATTTCCG

--

PB b

C. jejuni CDT B gene

(U51121)

P5

GAATCCGTTGGCACTTGGAATTTGCAAGGC

495

[40]

P6

GGATTCGTTAAAATCCCCTGCTATCATCCA

--

[40]


a GenBank or NCBI protein accession number indicated in brackets.

b Primers sequences were obtained from the PrimerBank database http://pga.mgh.harvard.edu/primerbank/index.html webcite

Kalischuk and Inglis BMC Microbiology 2011 11:53   doi:10.1186/1471-2180-11-53

Open Data