Table 2

Oligonucleotide primers used in this study

Target gene

Primer

Primer Sequence

Purpose

Reference


gyrA

gyrA12004

TGC CAG ATG TCC GAG AT

gyrA QRDR amplification

[12]


gyrA11753

GTA TAA CGC ATT GCC GC


parC

EC-PAR-A

CTG AAT GCC AGC GCC AAA TT

parC QRDR amplification

[43]


EC-PAR-B

GCG AAC GAT TTC GGA TCG TC


qnrA

qnrA-1A

TTC AGC AAG ATT TCT CA

qnrA detection

[42]


qnrA-1B

GGC AGC ACT ATT ACT CCC AA


qnrB

qnrB-CS-1A

CCT GAG CGG CAC TGA ATT TAT

qnrB detection

[42]


qnrB-CS-1B

GTT TGC TGC TCG CCA GTC GA


qnrS

qnrS-1A

CAA TCA TAC ATA TCG GCA CC

qnrS detection

[42]


qnr-1B

TCA GGA TAA ACA ACA ATA CCC


qepA

qepA-F

GCAGGTC CAGCAGCGGGTAG

qepA detection

[41]


qepA-R

CTTCCTGCCCGAGTATC GTG


adk

adkF

ATTCTGCTTGGCGCTCCGGG

MLST

[19]


adkR

CCGTCAACTTTCGCGTATTT


fumC

fumCF

TCACAGGTCGCCAGCGCTTC

MLST

[19]


fumCR

GTACGCAGCGAAAAAGATTC


gyrB

gyrBF

TCGGCGACACGGATGACGGC

MLST

[19]


gyrBR

ATCAGGCCTTCACGCGCATC


icd

icdF

ATGGAAAGTAAAGTAGTTGTTCCGGCACA

MLST

[19]


icdR

GGACGCAGCAGGATCTGTT


mdh

mdhF

ATGAAAGTCGCAGTCCTCGGCGCTGCTGGCGG

MLST

[19]


mdhR

TTAACGAACTCCTGCCCCAGAGCGATATCTTTCTT


purA

purAF

CGCGCTGATGAAAGAGATGA

MLST

[19]


purAR

CATACGGTAAGCCACGCAGA


recA

recAF

CGCATTCGCTTTACCCTGACC

MLST

[19]


recAR

TCGTCGAAATCTACGGACCGGA


MLST - multi-locus sequence typing; QRDR - quinolone-resistance determining region

Namboodiri et al. BMC Microbiology 2011 11:44   doi:10.1186/1471-2180-11-44

Open Data