Table 2

Primers used in this study

Name

Sequence 5' → 3'

Usage

Reference


ARB6

GGCACGCGTCGACTAGTACNNNNNNNNNNACGCC

PCR round 1

[59]

ARB2

GGCACGCGTCGACTAGTAC

PCR round 2

[59]

ME-O-extF

CGGTTTACAAGCATAACTAGTGCGGC

PCR round 1

This work

ME-O-intF

AGAGGATCCCCGGGTACCGAGCTCG

PCR round 2/sequencing

This work

ME-I-extR

CTCGTTTCACGCTGAATATGGCTC

PCR round 1

This work

ME-I-intR

CAGTTTTATTGTTCATGATGATATA

PCR round 2/sequencing

This work

GFP-extR

GGGTAAGTTTTCCGTATGTTGCATC

PCR round 1

This work

GFP-intR

GCCCATTAACATCACCATCTAATTC

PCR round 2/sequencing

This work


Martínez-García et al. BMC Microbiology 2011 11:38   doi:10.1186/1471-2180-11-38

Open Data