Table 6

Primers used in this study

Primer

Sequencea

Directionb


P1

tatt

    tctaga
tttcagtgcaat

F

P2

tta

    ggtacc
gcgaacgccagcaagacg

R

P3

taa

    ggtacc
ccggaattgccagctggg

F

P4

tta

    ggatcc
tccgcgcacatttccccg

R

P5

taa

    cccggg
aattctcatgtttgac

F

P6

tta

    agatct
ccatgccggcgataat

R

P7

tgcttcaacagtacgaattcactatccggttcaataccaagttgcatgacgcatgcctgcagggcgcg

F

P8

gttttgctgaatggcggcttcgttttgcccgccccaccatcacctgatgattatttgttaactgttaattgtc

R

P9

ggcaacaatttctacaaaacacttgatactgtatgagcatacagtataattgcttcaacagtacgaa

F

P10

gagaaatgccaaaagggccgcataaatgcagcccttgatggtaatttaacgttttgctgaatggcggc

R

P11

taa

    actagt
acgacagcagagtcctgtaccg

F

P12

tta

    ggtacc
tgaagcttgtcatgcaacttggtattgaac

R

P13

taa

    ggtacc
ggatcctcatcaggtgatggtggggcgg

F

P14

tta

    tctaga
tttgcgaacggcctgttcacgt

R

P15

gatagcacgtgctatcttgtgc

F

P16

tcgtcgcagacgctgttcgccg

R

P17

ctag

    tctaga
cgtcagtgagaatcagctcaaa

F

P18

caa

    ggtacc
atattagtacattcgtccagg

R

P19

cgc

    ggtacc
agcgctgaacacgttatagacat

F

P20

acat

    gcatgc
gaatagtcacgacgatatcttt

R

P21

ctag

    tctaga
cgtcagtgagaatcagctcaaaatc

F

P22

cgg

    ggtacc
atcaactcataaccagggcgttatc

R

P23

cgactttatctttacctcgaagctggtggat

F

P24

gttacggacacggagttatcggcgtgaata

R

P25

ctag

    tctaga
agattataacgcgctggg

F

P26

cgg

    ggtacc
gcgtattatttaccactggtc

R

P27

cgc

    ggtacc
taatcggggcgatttaacaac

F

P28

acat

    gcatgc
cttcgagcgatgaacgctct

R

P29

gtctataaagcgccggatgagaaacatgtc

F

P30

tcgacgatcgcttcgagcgatgaacgctct

R

P31

taa

    aagctt
gaccgcgactgtctgatcgt

F

P32

tca

    agatct
ctcgggcgcggagttgcccggc

R

P33

taa

    agatct
tga
    ctgcag
tgaaaaagcagtttgccacgat

F

P34

tta

    gagctc
agaaaggaataccggcatgaca

R

P35

taaagatctcgatataagttgtaattctc

F

P36

tta

    ctgcag
gcgaggtgccgccggcttcc

R

P37

tta

    ctgcag
tccgcgcacatttccccg

R

P38

ggggtaatgtcgtggaccatttgc

F

P39

ccgcggtaatccccggcactaccg

R

P40

gcgctacaaaccctgtggcaacaat

F

P41

gctgtgatcgcggacagcaagaatac

R

P42

ttctcaacataaaaaagtttgtgtaatactgaggatgcggcgtcacag

F

P43

gttacggacacggagttatcggcgtgaata

R


a The underlined sequences are enzyme sites mentioned in the text.

b Forward (F) or reverse (R) primers.

Zhang et al. BMC Microbiology 2011 11:31   doi:10.1186/1471-2180-11-31

Open Data