Table 1

Primer details for the PCR analysis of transformants

No.

Name

Sequence

Fragment

size (bp)


1

Hyg F

CGACGTTACTGGTTCCCGGT

2

Hyg R

GCGGGCACGTTAACTGAT

550

3

bR-gen 5'F

ACAAGACCTCTCGCCTTT

4

bR-Hyg 5'R

AGGTCGGAGACGCTGTCGAA

480

5

bR-gen 3'F

ATGCAGCTTGGGCTGTTCAG

6

bR-Hyg 3'R

CGACTCCCAACTCGACTA

590

7

Phleo F

GGGGACAAGTTTGTACAAAAAAGCAGGCT

8

Phleo R

GGGGACCACTTTGTACAAGAAAGCTGGGT

1020


Ish - Shalom et al. BMC Microbiology 2011 11:266   doi:10.1186/1471-2180-11-266

Open Data