Table 2

Primers used for qRT-PCR in this study

Primer name

5' 3' sequence

Reference


gyrB F

GGTGGCGACTTTGATCTAGC

[14]


gyrB R

TTATACAACGGTGGCTGTGC

[14]


fnbA F

ATTGAGACATTTAATAAAGCGA

[15]


fnbA R

TTTTGAATAATCGGACCATT

[15]


fnbB F

CACCGAAAACTGTGCAAGCA

[16]


fnbB R

TTCCTGTAGTTTCCTTATCAGCAACTT

[16]


Rasigade et al. BMC Microbiology 2011 11:263   doi:10.1186/1471-2180-11-263

Open Data