Table 1

Primer sequences used in this study

ORF Product

Locus Tag

Specificity

Sequence (5'-3')


Superoxide

Dsim GD12822

D. simulans

F - GTCGACGAGAATCGTCACCT

Dismutase (SOD)

R - GGAGTCGGTGATGTTGACCT


Surface Antigen

WRi 010990

Wolbachia

F - ATCAGGGTTGATGTTGAAGG

Wsp (Wsp)

wRi

R - CAGTATCTGGGTTAAATGCTG


Lyzozyme M1

WRi 012650

WORiA

F - GACTTTATGGCAGTATACCGA

(Lyz)

R - TGTTCCGTTGAATTTGTTCC


DNA

WRi 005640

WORiB

F - CTTAAATGACCATCAACCACAG

Methyltransferase (MTase)

R - GCTTCAATCAGGGAATTTGG


Contractile Tail

WRi 006970

WORiC

F- GTTGATGGTAGAGGTTATGCAG

Tube Protein

R - GAATATCCATACCACCAGCTC


Biliske et al. BMC Microbiology 2011 11:251   doi:10.1186/1471-2180-11-251

Open Data