Table 5

Primers designed for the expression of VP1s and VP4s

primers

sequences

endonuclease

fragments (bp)


EV71-VP1-2F

5'- ACGGATCCGGAGATAGGGTGGCAGAT -3'

BamHⅠ

EV71-VP1-2R

5'- CCTCTCGAGTTAAAGAGTGGTGATCGCTGTG -3'

XhoⅠ

911

EV71-VP4-2F

5'-CCGAATTCATGGGCTCGCAAGTG-3'

EcoRⅠ

EV71VP4-2R

5'-TCTCTCGAGTTACTTCAGCGGCGCTGC-3'

XhoⅠ

227

CA16-VP1-2F

5'- GAAGATCTGGGGGATCCTATCGCAGAC-3'

BamHⅠ

CA16-VP1-2R

5'- CCGCTCGAGTTACAGTGTTGTTATCTTG-3'

XhoⅠ

912

CA16-VP4-2R

5' -CGCCGAATTCATGGGGTCACAAGT -3'

EcoRⅠ

CA16-VP4-2F

5'- TATCTCGAGTTACTTGAGCGGCGGG -3'

XhoⅠ

229


F referred as forward primer and R referred as reverse primer.

Li et al. BMC Microbiology 2011 11:246   doi:10.1186/1471-2180-11-246

Open Data