Table 3

Primers used in this study.

Primera

Sequence (5'-3')

Amplicon Size (bp)

Reference


QacA/B_Fw

GCTGCATTTATGACAATGTTTG

628

[30]

QacA/B_Rv

AATCCCACCTACTAAAGCAG


Smr_Fw

ATAAGTACTGAAGTTATTGGAAGT

285

[18]

Smr_Rv

TTCCGAAAATGTTTAACGAAACTA


NorA_Fw

TTCACCAAGCCATCAAAAAG

620

[32]

NorA_Rv

CTTGCCTTTCTCCAGCAATA

[13]


NorA_Fw

TTCACCAAGCCATCAAAAAG

95

[32]

NorA_RT(Rv)

CCATAAATCCACCAATCCC

This study


NorB_Fw

AGCGCGTTGTCTATCTTTCC

213

[13]

NorB_Rv

GCAGGTGGTCTTGCTGATAA


NorC_Fw

AATGGGTTCTAAGCGACCAA

216

[13]

NorC_Rv

ATACCTGAAGCAACGCCAAC


MepA_Fw

ATGTTGCTGCTGCTCTGTTC

718

[13]

MepA_Rv

TCAACTGTCAAACGATCACG


MepA_RT(Fw)

TGCTGCTGCTCTGTTCTTTA

198

[13]

MepA_RT(Rv)

GCGAAGTTTCCATAATGTGC


MdeA_Fw

AACGCGATACCAACCATTC

677

[13]

MdeA_Rv

TTAGCACCAGCTATTGGACCT


MdeA_RT(Fw)

GTTTATGCGATTCGAATGGTTGGT

155

[33]

MdeA_RT(Rv)

AATTAATGCAGCTGTTCCGATAGA


16S_27f

AGAGTTTGATCMTGGCTCAG

492

[34]

16S_519r

GWATTACCGCGGCKGCTG


GrlA_Fw

TGCCAGATGTTCGTGATGGT

339

[35]

GrlA_Rv

TGGAATGAAAGAAACTGTCTC


GyrA_Fw

TCGTGCATTGCCAGATGTTCG

394

[35]

GyrA_Rv

TCGAGCAGGTAAGACTGACGG


aThe primers used in the RT-qPCR experiments are indicated by the RT label. Fw: forward; Rv: reverse. For norB, norC and smr, the same set of primers was used for both PCR and RT-qPCR, as well as the primer NorA_Fw.

Costa et al. BMC Microbiology 2011 11:241   doi:10.1186/1471-2180-11-241

Open Data