Table 2

List of primers

Name

Sequence (5' → 3')


BGHA236 HC

ATGCCIATYNCCRMCGGIGAYKC

BGHA246 HC

CRGCCTTCTTRTCCTCCATGG

BGHA240 HC

ATGGTCGADRTYCWGGAYTAYACC

BGHA241 HC

GARGCRCCRGCGTTMTTG

BGHA343

GAGCGYATGARYGTYTAYTTCA

BGHA344

GTGAACTCCATCTCRTCCATACC

BGHA70

TTAACA

    CAATTG
CGCGGTTTTTTGGGGTAGTCATC

MfeI

BGHA71

TTAACA

    CCTGCAGG
CGCGGTTTTTTGGGGTAGTCATC

SbfI

BGHA125

TTAACAG

    GGTACC
AAGTCAATTTTCACCAATCAAGC

KpnI

BGHA132

TGGTAT

    GCGATCGC
GTCAGAGTCAAACAAAGCCAGA

AsiSI

BGHA168

GGGTTTAAUACAGACGAAAGGGTTGTTGG

BGHA169

GGACTTAAUGTCTCTATCAGGACACGCAGA

BGHA170

GGCATTAAUTGGCTTTCTTTTCGTTTCTTG

BGHA171

GGTCTTAAUTGCTTCTGCAATTTCGACAC

BGHA98

GGTTTCGTTGTCAATAAGGGAA

BGHA256 HC

CATGGAGGGCTTCCAGAATA

BGHA255 HC

TTTTGCTGTGCTGTAGTCGTG

BGHA225

CCAGTTATCTGGGCAAACCAAAAG


Hansen et al. BMC Microbiology 2011 11:202   doi:10.1186/1471-2180-11-202

Open Data