Table 2

Oligonucleotide primers for Real-Time PCR detection of genes encoding for resistance to vancomycin (vanA, vanB, vanC1, vanC2), tetracycline (tet(L), tet(M), tet(S)), ciprofloxacin (gyrA), ampicillin (pbp5) and gentamicin (aac(6')-aph(2'))

Target gene

Primer name

Primer sequence (5' to3')

Positive control


van A

vanAFa

TGTGCGGTATTGGGAAACAG

ATCC 51559

vanARb

GATTCCGTACTGCAGCCTGATT

van B

vanBF

TCTGCTTGTCATGAAAGAAAGAGAA

ATCC 700802

vanBR

GCATTTGCCATGCAAAACC

tet(L)

tetLF

GGGTAAAGCATTTGGTCTTATTGG

RBH200523

tetLR

ATCGCTGGACCGACTCCTT

tet(M)

tetMF

GCAGAATATACCATTCACATCGAAGT

RBH200535

tetMR

AAACCAATGGAAGCCCAGAA

tet(S)

tetSF

CCATTGATATCGAAGTACCTCCAA

RBH200535

tetSR

AGGAAGTGGTGTTACAGATAAACCAA

gyr A

gyrAF

CGGATGAACGAATTGGGTGTGA

ATCC 51559

gyrAR

AATTTTACTCATACGTGCTT

pbp 5

pbp5F

GTTCTGATCGAACATGAAGTTCAAA

ATCC 51559

pbp5R

TGTGCCTTCGGATCGATTG

aac(6')-aph(2')

acc-aphF

TCCTTACTTAATGACCGATGTACTCT

ATCC 700802

acc-aphR

TCTTCGCTTTCGCCACTTTGA


Fa forward primer, Rb reverse primer

Rathnayake et al. BMC Microbiology 2011 11:201   doi:10.1186/1471-2180-11-201

Open Data